Cypraea, cowry, ciprea, cipree

2014-10-22T01:19:00.003-07:00

Lyncina carneola (Linnaeus, 1758)

Lyncina carneola, common name the Carnelian cowrie, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Description

These cowries reach 30–80 millimetres (1.2–3.1 in) in length. Their shape is rounded and the basic color is a pale orange-brown, with some transverse bands.

Distribution

This species occurs in the seas off Aldabra, Chagos, the Comores, the East Coast of South Africa, Eritrea, Kenya, Madagascar, the Mascarene Basin, Mauritius, Mozambique, the Red Sea, Réunion, the Seychelles, Somalia and Tanzania.

References

• Lyncina carneola( Linnaeus, 1758). WoRMS (2009). Lyncina carneola (Linnaeus, 1758). Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=216866 on 11 October 2010.

• Fishelson, L., 1971. Ecology and distribution of the benthic fauna in the shallow waters of the Red Sea. Mar. Biol., Berl. 10 2: 113-133

Subspecies Cypraea carneola crassa Gmelin, 1791 accepted as Lyncina carneola (Linnaeus, 1758)

Subspecies Cypraea carneola minor Dautzenberg, 1923 accepted as Lyncina carneola (Linnaeus, 1758)Subspecies Cypraea carneola sowerbyi Anton, 1838 accepted as Lyncina carneola (Linnaeus, 1758)

http://www.cypraea.eu/species/cypraea_carneola.htm

2014-01-17T08:43:00.002-08:00

Cypraea granulata W. H. Pease, 1862

Nucleolaria granulata, common name the "granulated cowry", is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Description

The shell of this quite uncommon cowry reaches on average 22–28 millimetres (0.87–1.1 in) of length, with a maximum size of 49 millimetres (1.9 in) and a minimum size of 15 millimetres (0.59 in). The shape of the shells is wide oval and appears flattened. The dorsum surface is rough, with a deep longitudinal line in the middle and many protuberances of various sizes, each other connected by thin ribs. The aperture is narrow and the outer and inner lips have fine teeth. The base is wide and the teeth are extended to cross the entire base as ribs on both sides. In the living cowries the mantle is pinkish or reddish, with well-developed papillae, which serve to camouflage these mollusks against the seabed.

While usually not too uncommon, for several years in the mid 1980s at least it was rarely seen, even in places that presumably saw little or no shell collecting pressure. Like some other species we have observed (e.g., Staphlaea semiplota in Hawaii and Erosaria beckii in the Marshall Islands), this species apparently undergoes periodic population fluctuations. This species is often considered to be endemic to the Hawaiian Islands, although Nucleolaria cassiaui from French Polynesia could be a variety.

DISTRIBUTION

This species is endemic to the Hawaii and Marquesas Islands.

HABITAT

Nucleolaria granulata lives in tropical shallow waters under rocks and caves usually at 5–25 metres (16–82 ft) of depth, feeding at night on sponges, algae or coral polyps.

REFERENCES

Felix Lorenz and Alex Hubert : A Guide to Worldwide Cowries, second revised edition, Conch Books, 2002

Subordinated taxa

subspecies Nucleolaria granulata cassiaui Burgess, 1965

subspecies Nucleolaria granulata granulata Pease, 1862

2013-05-14T08:48:00.001-07:00

Cypraea Albuginosa - Gray 1825

Size approx 2cm.

Superdomain: Neomura
Domain: Eukaryota
(unranked): Opisthokonta
(unranked) Holozoa
(unranked) Filozoa
Kingdom: Animalia
Superphylum: Lophotrochozoa
Phylum: Mollusca
Class: Gastropoda
Subclass: Orthogastropoda
Order: Littorinimorpha
Superfamily: Cypraeoidea
Family: Cypraeidae
Subfamily: Erosariinae
Tribe: Erosariini
Genus: Erosaria
Species: E. albuminosa

Fovea very broad, extending nearly to the lateral ocellus. Clypeus sparsely indistinctly punctured; pubescence on dorsulum abundant, the sculpture hidden.

_____________________

Ces belles porcelaines de forme allongée et ne dépassant pas 35 mm, sont appelées albuginosa (aubergine) en raison de la coloration parfois rose ou violette de leur base. Leur dénomination anglo-saxonne White Spotted Cowry, c’est-à-dire porcelaine à poix blancs, nous éclaire mieux sur leur face dorsale brune claire ponctuée de taches blanches chacune élégamment cerclée d’une nuance de brun plus foncée.

On les trouve du Golfe de Californie et de la mer de Cortés jusqu’à l’Équateur.

Elles sont présentes également aux îles Galápagos sous une forme differente : Cypraea albuginosa f. nariaeformis (Schilder & Schilder, 1930).

2013-04-30T08:23:00.004-07:00

Cypraea acicularis Gmelin, 1791

Caribbean Sea is not THE spot to look out for this family. TheCypraeidae family is very poorly represented there. We can find only main four species :

- the very common Cypraea cinerea (Gemlin, 1791) (Now splited in several sp. and ssp. like "brasilensis")
- the common Cypraea acicularis (Gemlin, 1791)
- the very uncomon Cypraea zebra (Linné, 1758)
- the very rare Cypraea surinamensis (Perry, 1811)

The Cypraea acicularis is a very nice cowrie. It's deep yellow to brown coloration makes it a very nice shell to look at. This specie is very close to it's Mediterranean Sea cousin : the Cypraea spurca. Of course there are some diffenrences.

The biggest difference, from my field experience, it the base color wich is cream with the Cypraea spurca and white with the Cypraea acicularis.

It’s possible to find intergrades.

The dorsum can be really the same between the two species, even if the Cypraea spurca cannot get the very light yellow color of the Cypraea acicularis.

Cypraea (Erosaria) acicularis ssp acicularis

Cette petite porcelaine (sa taille ne dépasse guère 25 mm) se rencontre entre 10 et 40 m de fond de la Floride jusqu’au Brésil.

Les taches jaunes orangées qui mouchettent sa coquille lui ont valu le nom anglais de « Atlantic Yellow Cowry »

Cypraea (Erosaria) acicularis sanctaehelenae

Décrite par Schilder, 1930. Cette sous-espèce de Cypraea acicularis ne se trouve que sur les rivages de l'Île Sainte-Hélène et de l'île de l'Ascension

2013-04-16T08:36:00.003-07:00

CYPRAEIDAE - Cypraea achatidea (Sowerby, 1837)

Schilderia achatidea common name Agate Cowry, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Description

The shell size varies between 22 mm and 50 mm. The dorsum surface is usually brown, while the base is white.

Distribution

This species can be found in the Mediterranean sea and in northwestern Africa.

Subspecies

· Schilderia achatidea achatidea Sowerby, 1837

· Schilderia achatidea inopinata Schilder, 1930

http://www.cypraea.eu/species/cypraea_achatidea.htm

Comportamento di Schilderia achatidea (Sowerby,1837) in cattivitá Ricardo Vega Luz

Riteniamo che le nostre osservazioni possono contribuire ad una migliore conoscenza del comportamento di questa specie e ci auguriamo, quindi che esse, unitamente alle fotografie, -a nostra conoscenza le prime che mostrano il molusco vivo- possano essere di qualche utilitá agli studiosi della malacofauna mediterranea e a quelli della famiglia Cypraeidae.
A partire dal gennaio 1981 furono raccolti un certo numero di esemplari di Schilderia achatidea provenienti dalla zona infralitorale della costa della provincia di Granata (Spagna); la maggior parte degli esemplari giunsero nelle nostre mani morti, o in pessime condizioni. La cattura era avvenuta con reti a strascico, alla profonditá media di 40 metri, a volte unitamente ad esemplari di Zonaria pyrum (Gmelin, 1791) e di Mitra zonata (Marryat, 1817).
Il 22 maggio 1981, verso le ore 18 fu dragato un esemplare di S. achatidea, insieme con una Z. pyrum, a 32 m. di profonditá. Un'oradopo le due cipree vennero introdotte in un recipiente contenente circa un litro d'acqua, sul cui fondo rimasero per 18 ore, per essere poi immesse in un acquario di 35 litri, climatizzato.
La S. achatidea si sistemó sotto una pietra ricoperta dall'alga cianoficea Ulva lactuca, cioé nel punto di minore luminositá di tutto l'aquario. In questa posizione, senza spostamenti di rilievo, il molusco rimase per circa 12 giorni, con l'estremitá cefalica rivolta verso la superficie e il mantello parzialmente espanso. Succesivamente fu notato un notevole cambiamento nel comportamento dell'animale, che divenne piú attivo e cominció ad effettuare degli spostamenti, con velocitá a volte superiore a quella di Z. pyrum e calcolabile, approssimativamente in 5 cm al minuto. Gli spostamenti erano abbastanza costanti e l'animale percorreva, ripetendolo, un circuito che partiva dalla pietra centrale, toccava un cristallo laterale, fino a raggiungere la superficie dell'acqua per poi discendere lungo lo stesso cristallo fino al fondo sabbioso e raggiungere di nuovo la pietra centrale, per la quale il mollusco sembrava nutrire una particolare preferenza. Intorno ad essa, infatti trascorreva la maggior parte del tempo, sia in atteggiamento di riposo, sia in fase di attivitá, quando percorreva piú volte la superficie della pietra, passando il sifone boccale, o proboscide fra le alghe, muovendo al contempo alternativamente e ritmicamente i tentacoli. Noi riteniamo che questo comportamento debba essere riferito a scopi alimentari. Nelle fasi di riposo il mollusco aveva il mantello maggiormente espanso, a volte totalmente; se, per una qualsiasi ragione il mollusco si sentiva disturbato, il mantello veniva bruscamente ritirato. Il medesimo si verificava se la illuminazione veniva aumentata all'improvviso.
L'animale morí il 5 luglio 1981 a causa della contaminazione dell'acqua provocata dalla descomposizione di alcuni esemplari di Lithophaga lithophaga (L.) immessi nell'acquario quattro giorni prima. Anche Z. pyrum risentì di quella contaminazione, ma fu possibile salvarla cambiando l'acqua. Oltre ai molluschi di cui abbiamo parlato, l'acquario conteneva esemplari di Luria lurida (L.) Coralliophila meyendorffi(Calcara), Coralliophila babelis (Requien) ed altri. Misure di S. achatidea: lunghezza min. 26.7, altezza mm 19.4, larghezza mm 20.

2013-02-12T01:12:00.002-08:00

Macrocypraea cervus (Linnaeus, 1771)

Macrocypraea cervus, the 'Atlantic Deer Cowrie', is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Distribution

Caribbean Sea
Cuba
Gulf of Mexico

Mexico

Description

This species is one of the largest cowries and it is quite similar in shape and colour toMacrocypraea cervinetta, but its size is much bigger. The maximum recorded shell length is 190 millimetres (7.5 in), while minimum length is about 40 millimetres (1.6 in).

This cowry is elongated, its basic colour is light brown, with small whitish ocellated spots on the dorsum, like a young fawn (hence the Latin name cervus, meaning 'deer'). Juveniles are without spots. The dorsum shows also a few trasversal clearer bands and a longitudinal line where the two edges of the cowrie mantle meet. The apertural teeth is dark brown. The mantle of the living cowries is dark greyish and completely covered by short fringes.

Habitat

Living cowries can mainly be encountered under corals and rocks in shallow waters at a maximum depth of 35 m. They feed on algae.

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
Depth range (m): 33 – 33

Temperature range (°C): 23.384 - 23.384
Nitrate (umol/L): 1.004 - 1.004
Salinity (PPS): 36.162 - 36.162
Oxygen (ml/l): 4.675 - 4.675
Phosphate (umol/l): 0.138 - 0.138
Silicate (umol/l): 0.942 - 0.942

Barcode data

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browserfor more complete information about this specimen and other sequences.

GBMLS1142-06|AY161719|Macrocypraea cervus| ---------------------------------------------------------GGTATATGATCAGGTTTAGTTGGGACAGCCCTT---AGTCTATTAATTCGAGCGGAGCTAGGACAACCAGGAGCT
CTTTTAGGAGAT---GACCAATTATATAATGTAATTGTAACAGCTCATGCATTTGTTATA
ATTTTCTTTCTGGTCATACCTATAATGATTGGTGGGTTTGGAAACTGACTTGTT
CCCCTGATA--TTAGGAGCTCCAGATATAGCCTTTCCTCGTCTAAATAATATGAGTTTTTG
ACTTCTGCCTCCAGCTTTGCTACTCCTTCTTTCTTCCGCGGCCGTTGAAAGGGG
AGTTGGGACGGGATGAACAGTTTATCCTCCCTTAGCCGGTAATCTTGCACATGC
TGGGGGGTCTGTTGATCTA---GCTATTTTTTCGTTACATCTCGCTGGTGTTTCTTCTATTTTAGGTGCTGTAAATTTT
ATTACAACAATCATTAATATACGATGACGAGGTATGCAATTTGAGCGGCTTCCA
TTATTCGTTTGATCAGTAAAAATTACTGCAGTTCTTCTTCTTCTTTCTTTACCTGTT
TTGGCTGGA---GCCATTACAATATTGTTAACTGATCGAAATTTTAACACTGCTTTTTTTGATCCAGC
GGGGGGTGGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
-- end --

2013-02-06T09:24:00.001-08:00

Cypraea testudinaria Linnaeus, 1758

Classification: Biota > Animalia (Kingdom)
> Mollusca (Phylum) > Gastropoda (Class)
> Caenogastropoda (Subclass) > Littorinimorpha (Order)
> Cypraeoidea (Superfamily) > Cypraeidae (Family)
> Cypraea (Genus)

Direct child taxa Subspecies Cypraea testudinaria ingens (Schilder & Schilder) accepted as Chelycypraea testudinaria (Linnaeus, 1758)

Distribution

Aldabra
Chagos
Comores
Kenya
Madagascar
Mascarene Basin

Mauritius

Mozambique

Reunion

Seychelles

Tanzania

Description

The shells of these quite uncommon cowries reach on average 90–110 millimetres (3.5–4.3 in) of length, with a minimum size of 75 millimetres (3.0 in) and a maximum size of 142 millimetres (5.6 in). They are variable in pattern and color. The shape is oval or sub-cylindrical, the dorsum surface is smooth and shiny, the basic color is whitish or yellowish and it is covered by very irregular dark brown patches and spots. The margins are white or pale brown, with some large dark dots. The base may be whitish, pale brown or pink, the aperture is long and narrow and the teeth are white, short and fine. In the living animal the mantle is bluish-greyish and almost transparent, while the sensorial papillae are lighter and rather long. The mantle and foot are well developed. The lateral flaps of the mantle can completely hide the dorsum surface.

2012-11-27T02:29:00.000-08:00

Monetaria moneta (Linnaeus, 1758)
AphiaID: 216874

Classification: Biota > Animalia (Kingdom)

> Mollusca (Phylum)

> Gastropoda (Class)

> Caenogastropoda (Subclass)

> Littorinimorpha (Order)

> Cypraeoidea (Superfamily)

> Cypraeidae (Family)

> Monetaria (Genus)

Status

accepted

Record
status

Checked by Taxonomic Editor

Rank

Species

Parent

Monetaria Troschel, 1863

Synonymised
taxa

Cypraea moneta Linnaeus, 1758 (original combination)
Monetaria icterina (Lamarck) (Synonym)

Sources

basis of record: Verdcourt, B. (1954). The cowries of the East African Coast (Kenya, Tanganyika, Zanzibar and Pemba). Journal of the East Africa Natural History Society 22(4) 96: 129-144, 17 pls.

from synonym: Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey (look up in IMIS)

from synonym: Branch, G.M. et al. (2002). Two Oceans. 5th impression. David Philip, Cate Town & Johannesburg., available online at http://books.google.es/books?id=W_2QB8ftLgcC

Vernacular
Names

Language	Name
English	money cowrie

Environment

marine

Distribution

Aldabra (from synonym)
Chagos (from synonym)
Comores (from synonym)
East Africa
East Coast of South Africa (from synonym)

Kenya

(from synonym)

Madagascar

(from synonym)
Mascarene Basin (from synonym)

Mauritius

(from synonym)

Mozambique

(from synonym)
Red Sea
Reunion (from synonym)

Seychelles

(from synonym)

Somalia

(from synonym)

Tanzania

(from synonym)

Monetaria moneta, commonly known as the money cowry, is a species of small sea snail, a marine gastropod mollusk in the family Cypraeidae, the cowries.

The species is called money cowry because the shells were historically widely used in many Pacific and Indian Ocean countries as a form of exchange before coinage was in common usage. It is still used in divination rituals by some African animist tribes.

Subspecies and formae

§ Monetaria moneta barthelemyi (f) Bernardi, M., 1861

§ Monetaria moneta erosaformis (f)

§ Monetaria moneta harrisi (f) Iredale, T., 1939

§ Monetaria moneta icterina (f) Lamarck, J.B.P.A. de, 1810

§ Monetaria moneta rhomboides (f) Schilder, F.A. & M. Schilder, 1933

§ Monetaria moneta tuberculosa (f) Quoy, J.R.C. & J.P. Gaimard, 1834

Distribution

This is a very common species which is found widely in Indo-Pacific tropical waters. It is present in numerous regions, including East and South Africa, Madagascar, the Red Seaand the Persian Gulf, eastern Polynesia, Galapagos, Clipperton and Cocos islands off Central America, southern Japan, Midway andHawaii, and northern New South Wales and Lord Howe Island.

Habitat

This cowry lives in intertidal rocky areas and shallow tide pools among sea weed, coralremains and empty bivalve shells. It can be found on and under rocks in shallow water and on exposed reefs at low tide. Like all cowries, it feeds on algae and marine vegetation growing on loose rocks and pieces of dead coral.

Shell description

The shell is small (30 to 45 mm long). It is white to straw-colored, and sometimes has a gold-colored ring around the dorsal area similar to the gold ring found on the shell ofCypraea annulus (gold-ringed cowry).

Human uses

Shells of this cowry were commonly used as a medium of exchange in many areas ofAfrica, Asia and the Pacific islands until the late 19th century.It was also traded to Native Americans by European settlers.

The shell continues to be popular today in jewelry and for decoration of such items as baskets and wall hangings.

In India specially Kerala Monetaria moneta (in Malayalam Monetaria moneta named as Kavidi കവിടി) used toPrediction in Hindu astrology as "Prashnam". For Prashnam, 108 Monetaria moneta are used and they are rotated a number of times, the blessings of God and Guru are invoked. A portion of the Kavadis are separated and counted to find out the ruling planet at that time. The results of the Prasna horoscope ( A horoscope formulated at the time of arrival of the persons) are compared with the results of the Prasnam, and the predictions are pronounced.

2012-10-24T01:42:00.002-07:00

Lyncina aurantium (Gmelin, 1791)

Classification: Biota > Animalia (Kingdom) >
Mollusca (Phylum) >
Gastropoda (Class) >
Caenogastropoda (Subclass) >
Littorinimorpha (Order) >
Cypraeoidea (Superfamily) >
Cypraeidae (Family) >
Lyncina (Genus)

Status

accepted

Record
status

Checked by Taxonomic Editor

Rank

Species

Parent

Lyncina Troschel, 1861

Synonymised
taxa

Cypraea aurantium Gmelin, 1791 (original combination)

Source

basis of record: Lorenz F. & Hubert A. (2000) A guide to worldwide cowries. Edition 2. Hackenheim: Conchbooks. 584 pp.

Vernacular
Names

Language	Name
English	golden cowrie

Links

To Barcode of Life (2 barcodes)
To Biodiversity Heritage Library (1 publication)
To Encyclopedia of Life
To GenBank (3 nucleotides; 2 proteins)

LSID

urn:lsid:marinespecies.org:taxname:216865

Lyncina aurantium, common name the golden cowrie, is a species of sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Distribution

This is an uncommon-to-rare species which is found in the tropical waters of the west-central to south-central Pacific Ocean.

Habitat

This animal is usually found on the ocean side of islands, on the reef, at depths of 30 to 100+ feet. It normally hides in the coral during daylight and comes out to feed at night.

Shell description

This is a large cowry (80 to 100 mm long). The shell that is yellowish brown to reddish orange on the dorsum, with white to cream colored margins. The mantle of the golden cowry is a combination of dark gray with translucent spots and patches that the orange color of the shell shows through. The scattered branching papillae are brownish gray, often white at the bases and tips.

Human use

These rare shells are prized by collectors. In the past, they were worn by Fijian chiefs as a symbol of rank or privilege.

2012-10-04T01:26:00.002-07:00

Leporicypraea mappa, Linneo 1758

Genere Leporicypraea

Con solo due specie così fortemente tipizzate da essere assolutamente inconfondibili, dalla forma enflata (condivisa col genere Lyncina) e dal pattern che nel tratteggio longitudinale rimanda al genere Mauritia, questo gruppo di cipree potrebbe da solo giustificare un'ampia collezione...

Originatesi presumibilmente da precursori pliocenici originari dell'Arcipelago della Sonda, vivono nelle barriere madreporiche dell'Indopacifico, dove si riproducono con modalità indiretta, originando veliger a lunga fase planctonica che sono tra i responsabili dell'ampia diffusione.

Leporicypraea mappa mappa (Linnaeus 1758)

Leporicypraea mappa viridis (Kenyon 1902)

Leporicypraea mappa admirabilis Lorenz 2002

Leporicypraea mappa rosea (Gray 1824)

Leporicypraea mappa aliwalensis Lorenz 2002

Leporicypraea geographica geographica (Sch. & Sch. 1933)

Leporicypraea geographica rewa (Steadman & Cotton 1943)

Leporicypraea valentia valentia (Perry 1811)

https://sites.google.com/site/conchologistatwork/cowrypedia/lista-delle-specie

***

Leporicypraea mappa (previously known as Cypraea mappa), common name the map cowry, is a species of cowry, a sea snail, amarine gastropod mollusk in the family Cypraeidae, the cowries. It is considered an economically important species in the Indo-West Pacific, usually collected both for food and shell trading.The map cowry was named after its distinct color pattern, mainly because of the longitudinal lines and the easily distinguishable and sinuous mantle groove, which creates a resemblance to ancient maps

Taxonomy

Leporicypraea mappa was previously subordinated to the genus Cypraea. In the currently most accepted taxonomy of the Cypraeidae by Lorenz & Hubert (2000), this species is considered to be within the genus Leporicypraea, with several subspecies. Recently, the division of this taxon in two or even three nominal species based on morphological and molecular characters has been suggested.

Subspecies

Subspecies of Leporicypraea mappa include according to the World Register of Marine Species (WoRMS) :

§ Leporicypraea mappa admirabilis Lorenz, 2002

§ Leporicypraea mappa aliwalensis Lorenz, 2002

§ Leporicypraea mappa mappa (Linnaeus, 1758)

The Indo-Pacific Molluscan also includes :

§ Leporicypraea mappa rosea (Gray, 1824)

§ Leporicypraea mappa panerythra (Melvill, 1888)

§ Leporicypraea mappa viridis (Kenyon, 1902)

§ Leporicypraea mappa geographica (Schilder & Schilder, 1933)

Shell description

The maximum shell length of this species is up to 10 cm, but it more commonly grows up to about 8 cm.

The shell of Leporicypraea mappa is globose, with a near elliptical, slightly elongate outline. In affinity to other Cypraeidae, the aperture of the shell is very narrow, and relatively long. Both the inner and outer lips are ornamented with arrays of small teeth, though the teeth of the outer lip are shorter and stronger in comparison to the teeth of the inner lip, which are thinner and more numerous. Its dorsal side is normally inflated, while the ventral side of the shell is slightly concave.

The shell is colored white or cream, with several longitudinal brown lines, which are sometimes interrupted by circular empy spaces. The cursory dorsal mantle groove line is dissimilar to the shells general color pattern, completely devoid of lines, thus easily perceivable. Its sinuous appearance, with several branches and notches, makes it a diagnostic character for this species. This exotic color pattern gives an appearance similar to that of ancient maps, hence the specific and common names. Both the ventral side of the shell and the labral teeth may vary greatly in color, assuming shades of white or cream, or even purple, brown, orange or pink.

Distribution

Leporicypraea mappa is widely distributed in the Indo-Pacific. It is present in many regions, including East Africa, Madagascar, southeastern Red Sea, eastern Polynesia, southernJapan, Australia and New Caledonia.

This exceptionally wide range may possibly be an artifact. Some conchologists claim that the taxonomy of the species is poorly resolved; if the map cowry is in fact confirmed as being two or more cryptic species, then this could drastically change the range of its distribution.

Ecology

Habitat

The map cowry lives in the intertidal and sublittoral zones, usually in coral reef areas, dwelling under slabs and stones at depths of 45 m.

Human uses

The flesh of the map cowry is edible, and it is commonly collected by local fishermen for food and shell trading wherever it occurs. It is sold in fish markets in the northernPhilippines. The shells of Cypraea mappa (as it was previously known) were considered rare, exotic and beautiful, and were highly prized by private shell collectors in the late 1950s.

http://www.cypraea.eu/species/mappa.htm

2012-09-27T02:43:00.002-07:00

Cypraea tigris Linnaeus, 1758

Nome latino

Cypraea Tigris

Nome comune

Ciprea tigrata

Dimensioni

Sino a 8 cm. In acquario 4 / 6 cm.

Valori dell' acqua

Temp. 24° / 27° Densità 1022 / 1024 PH 8,4

Splendido Gasteropode, appartenente all'ordine dei Monotocardi, famiglia dei Cypreidi; endemica nell'oceano Indiano.

Estremamente caratteristica per la forma della sua conchiglia, lucida e colorata e dalla livrea simile al mantello di una tigre, di colore variabile dal bianco al marrone scuro con sopra piccoli punti neri ed irregolari.

Sopra il piede, organo muscolare locomotore, presenta una testa grossa, con due tentacoli lunghi, sottili e ravvicinati, alla cui base si trovano gli occhi ed il sifone.

Una piega cutanea appena sopra il piede, detta mantello, si allarga da ambo i lati e si rialza in modo da coprire per intero la conchiglia calcarea, proteggendola dagli urti e dai danni; dal mantello si innalza una grande quantità di appendici tattili a forma tentacolare, molto sensibili.

In natura vive adagiata sul Reef, muovendosi tra le roccie, comunque sempre in posti poco illuminati o decisamente bui; estremamente vivace si sposta di continuo muovendo il piede muscoloso.

In natura la C. Tigris si nutre di piccoli Crostacei, Poriferi, Celenterati ed Antozoi che caccia incessantemente.

Facile da allevare in acquario, sia per l'alimentazione, sia per la relativa insensibilità alle caratteristiche chimico-fisiche dell'ambiente pone dei problemi solo per quanto riguarda l'accoppiamento con gli altri invertebrati i quali potrebbero finire col diventare sue prede.

In acquario và nutrita con mangime surgelato, artemie e chironomus, o con piccoli pezzi di polpa di cozze o di pesce.

Per quanto riguarda i valori chimici dell'acqua, questa deve essere ben filtrata, aereata e priva di nitriti e di nitrati.

Sono consigliabili regolari cambi dell'acqua con sifonature del fondo ed aggiunte di oligoelementi e bioelementi bilanciati.

Per tutti questi motivi potrebbe essere allevata anche nell'acquario di invertebrati dell'acquariofilo principiante.

***

Cypraea tigris, commonly known as the tiger cowry, is a species of cowry a large sea snail, marine gastropod mollusk in the family Cypraeidae, the cowries.

Taxonomy

The tiger cowry was one of the many species originally described by Linnaeus in his 18th century work, Systema Naturae, and the species still bears its original name of Cypraea tigris. Its specific epithet tigris relates to its common name "tiger" (the shell however is spotted not striped). This species is the type species of the genus Cypraea.

Subspecies and formae

§ Cypraea tigris incana (f) Sulliotti, G.R., 1924

§ Cypraea tigris lyncicrosa (f) Steadman, W.R. & B.C. Cotton, 1943

§ Cypraea tigris pardalis (f) Shaw, 1795

§ Cypraea tigris var. schilderiana Cate, C.N., 1961 The variety Cypraea tigris var. schilderiana was recognized by Cate in 1961. It differs from Cypraea tigris in its large size (10–13 cm) and the lack of a thick marginal callus. This variety is found in the Hawaiian Islands, and Vietnam

§ Cypraea tigris tuberculifera (f) Sulliotti, G.R., 1924

Description

Roughly egg-shaped and dextral, the glossy shell is large and heavy for a cowry. It measures up to 15 cm (6 in) in length, and the upper or dorsal side is white, pale bluish-white, or buff, densely covered with dark brown or blackish barely circular spots. Akin to many other Cypraea snails, the shells surface is notably effulgent, as if it were deliberately polished. There is sometimes a blurred red line along the length of the shell at the midline on the dorsal surface. The lower margins are rounded (that is, there is no sharp margin between the upper and lower surfaces of the shell as is found in some other cowries). The ventral side is white or whitish, and the shell opening is lined with tooth-like serrations.

As is the case in almost all cypraeids, two lateral extensions of the mantle are able to extend so as to cover the shell completely, meeting at the midline of the dorsal surface. The mantle can also withdraw into the shell opening when threatened. In this species, the exterior surface of the mantle has numerous pin-like projections that are white-tipped.

Distribution and habitat

The tiger cowrie is found on the ocean floor in the Indian and western Pacific Oceans, across the waters of Micronesia and Polynesia, the Coral Sea and around the Philippines. Along the Australian Coast it is found from Northern New South Wales to northern Western Australia, as well as Lord Howe Island, and along the east coast of Africa includingMadagascar. Found between depths of 10 and 40 metres (35–130 ft), it is often associated with live coral colonies, such as the table-forming Acropora, either found on the reefs themselves or the sandy sea bottom nearby. Once common, it is now much less abundant due to shell collecting and the destruction of its habitat by such processes as dynamite fishing, especially in shallower areas. Carnivorous, the adult tiger cowrie eats coral and various invertebrates, while juveniles eat algae.

This species is endangered in Singapore.

Human use

Despite the fact that this species does not occur in the Mediterranean Sea, shells of the tiger cowrie and the related panther cowrie, Cypraea pantherina, have been unearthed atPompeii, the ancient Roman city near Naples, Italy, where these shells may have been used as some form of ornament. It is also conceivable that the shells were part of a natural history collection. There was an interest in natural history at the time, as exemplified by Pliny the Elder who wrote extensively about seashells in his book Natural History and who died investigating the eruption of Vesuvius.

The shells of this species of cowry are still popular among shell collectors, and are also used as a decorative object, even in modern times.

The shell of Cypraea tigris is believed to help to facilitate childbirth: some women in Japan hold a shell of this species during childbirth.

Large cowry shells such as that of this species were used in Europe in the recent past as a frame over which sock heels were stretched for darning, i.e. instead of using a darning egg. The cowry's smooth surface allows the darning needle to be positioned under the cloth more easily than when using a darning mushroom made of wood.

Classification: Biota > Animalia (Kingdom) >

Mollusca (Phylum) >

Gastropoda (Class) >

Caenogastropoda (Subclass) >

Littorinimorpha (Order) >

Cypraeoidea (Superfamily) >

Cypraeidae (Family) >

Cypraea (Genus)

Status

accepted

Record
status

Checked by Taxonomic Editor

Rank

Species

Parent

Cypraea Linnaeus, 1758

Sources

basis of record: Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey (look up in IMIS)

additional source: Branch, G.M. et al. (2002). Two Oceans. 5th impression. David Philip, Cate Town & Johannesburg., available online athttp://books.google.es/books?id=W_2QB8ftLgcC

additional source: Kay, E.A. (1979) Hawaiian marine shells. Reef and shore fauna of Hawaii. Section 4: Mollusca. Bernice P. Bishop Museum Special Publications, 64, xviii + 1–653.
page(s): 202

additional source: Lorenz & Hubert (2000). A guide to worldwide cowries. ConchBooks 1-584
page(s): 65

additional source: Burgess, C.M. (1985) Cowries of the World. Gordon verhoef, Seacomber Publications, South Africa, Cape Town. XIV + 289 pp.
page(s): 76

additional source: Dodge, H. (1953) A historical review of the mollusks of Linnaeus. Part 2. The class Cephalopoda and the genera Conus and Cypraea of the class Gastropoda. Bulletin of the American Museum of natural History, 103(1): 1-134.
page(s): 79

Vernacular
Names

Language	Name
English	tiger cowrie

Direct child
taxa
[show all]

Subspecies Cypraea tigris schilderiana Cate, 1961
Subspecies Cypraea tigris tigris Linnaeus, 1758

Environment

marine

Distribution

Aldabra
Chagos
Comores
East Coast of South Africa
Kenya
Madagascar
Mascarene Basin

Mauritius

Mozambique

Red Sea
Reunion

Seychelles

Somalia

Tanzania

Links

To Barcode of Life (6 barcodes)
To Biodiversity Heritage Library (141 publications)
To Encyclopedia of Life
To GenBank (10 nucleotides; 7 proteins)
To USNM Invertebrate Zoology Mollusca Collection

Notes

Description: A solid, thick, heavy, inflated shell, up to 13 cm. Dorsally white or pale reddish-brown with large dark brown spots, and sometimes a reddish longitudinal stripe. Habitat: under coral and boulders in shallow or deep water. Distribution: Indo-Pacific. Regional names: Kis. Kururu, Makunguru; Port. Cipreia tigre. (Richmond, 1997). [details]

Type species: Cypraea tigris Linnaeus, 1758 is the type species of the genus Cypraea Linnaeus, 1758, which is the type genus of the family Cypraeidae Rafinesque, 1815.

2012-09-25T08:47:00.002-07:00

Luria lurida (Linne', 1758)

photo of Andrea Nappus- Quartu Sant'Elena (CA)

Come spesso capita, le osservazioni più interessanti sugli animali che si ospitano in acquario avvengono per caso. La mia passione per le cipree mi aveva portato ad allevarne alcuni esemplari e, come faccio di regola, a cercare preventivamente tutto ciò che in letteratura fosse stato scritto sulla Luria lurida e che mi potesse interessare da un punto di vista acquariologico.

In realtà come per la maggior parte degli animali del Mediterraneo allevati in cattività le informazioni sui vari testi sono molto vaghe: le schede sugli animali sono del tutto simili tra loro e spesso compilate con una vaghezza disarmante. E così si scopre che moltissimi animali sono detritivori (pare il termine usato con meno parsimonia dagli “esperti”), altri (quando non si sa di che cosa si nutrano veramente) diventano all’occorrenza ottimi brucatori o addirittura altri cambiano famiglia e specie a seconda dell’autore! Si pensi alla Berthella aurantiaca, innocuo gasteropode per la cronaca e spietata cacciatrice di Actinia equina e Actinia cari nei fatti (nessun testo di acquariologia ne parla). Si pensi alla confusione fra Condilactys, Bunodactys, Cribinopsis, Phymanthus pulcher e così via: per qualcuno le precisazioni sui nomi potrebbero sembrare forse superflue ma in realtà è solo grazie ad una corretta identificazione che l’acquariofilo intelligente può allevare nel migliore dei modi i suoi ospiti. La Condylactis ad esempio è un “animale di sabbia”: vive su fondali sabbiosi e non su roccia. La Cribinopsis vive su roccia. Di Cribinopsis però non ne parla nessuno ed ecco che ogni anemone con tentacoli grigio-dorati con le punte viola diventa Condylactis.

Il discorso sulla Luria lurida prende le mosse proprio da alcune errate convinzioni che l’hanno catalogata come specie che si ciba di alghe oltre che di spugne. Detto questo con il primo esemplare di Luria lurida mi ero limitato esclusivamente a fornire vegetali vari ed in quantità rilevante per cercare di far trovare a proprio agio l’animale. Dalle osservazioni però qualcosa non quadrava: i vegetali non venivano calcolati dal mio esemplare che invece preferiva stazionare vicino alle piccole spugne. Si sa che spesso gli animali in cattività assumono dei comportamenti non proprio abitudinari per la propria specie ma che addirittura cambiassero dieta mi pareva troppo. Dopo circa 2 mesi la Luria, sempre sotto attenta osservazione, aveva divorato una tethya aurantium ed altre piccolissime spugne ma tutte le specie vegetali della vasca erano perfettamente intatte.

Decisi allora di non immettere più spugne nella vasca per vedere se si era trattato solo di una questione di preferenze alimentari: la Luria allietò la mia vasca per altri 4 mesi e poi improvvisamente morì. Togliere dalle proprie vasche un animale morto è sempre una sconfitta e proprio perché si trattava di un animale che mi interessava particolarmente la cosa mi diede fastidio e non poco. In realtà i fatti però parlavano chiaro: decisi di riprovare e misi un altro esemplare nella vasca che nel frattempo era stata adeguatamente rifornita di spugne di vario genere. Il nuovo inquilino passava da una spugna all’altra non calcolando minimamente i vegetali. Era chiaro che la sua dieta si basava esclusivamente sulle spugne, ma si trattava si capire quali fossero le sue spugne preferite. Dopo qualche mese di osservazioni e prove con diversi poriferi sono arrivato alla conclusione che il cibo preferito della Luria lurida è la spugna Aiplysina aerophoba su cui si rinvengono numerosi esemplari in mare durante le ore notturne. Non disdegna neppure Tethya aurantium e qualche altra specie, ma senza dubbio l’Aiplysina è il suo pasto preferito.

Restava da chiarire ancora un dubbio: fin dalla prima settimana mi ero accorto che il primo esemplare emetteva escrementi contestualmente o quasi all’assunzione di cibo sotto forma di cilindretti bluastri e scuri. L’assenza di escrementi in una vasca priva di qualsiasi altro organismo che non fosse sedentario mi aveva portato a pensare che l’esemplare in questione non mangiasse.

Tale situazione era rimasta inalterata fino alla morte dell’animale esattamente a distanza di circa 4 mesi dall’ultimo avvistamento di feci. Ne consegue che si tratta di un animale che può stare anche 4 mesi senza cibarsi. Certo, a posteriori, non ripetendo l’errore di non immettere più spugne in vasca la mia prima Luria lurida forse sarebbe ancora in vita. In ogni caso spero che queste osservazioni possano aiutarci ad ospitare gli esemplari di questo bellissimo animale garantendo loro almeno una corretta alimentazione oltre ad una temperatura dell’acqua rigorosamente mai al di sopra dei 24°C.

Classification: Biota >
Animalia (Kingdom) >
Mollusca (Phylum) >
Gastropoda (Class) >
Caenogastropoda (Subclass) >
Littorinimorpha (Order) >
Cypraeoidea (Superfamily) >
Cypraeidae (Family) >
Luria (Genus)

Status

accepted

Record
status

Checked by Taxonomic Editor

Rank

Species

Parent

Luria Jousseaume, 1884

Synonymised
taxa

Cypraea lurida Linnaeus, 1758 (original combination)

Sources

basis of record: Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213 (look up in IMIS) [details]

additional source: Rolán E., 2005. Malacological Fauna From The Cape Verde Archipelago. Part 1, Polyplacophora and Gastropoda. (look up in IMIS) [details]

from synonym: Linnaeus, C. (1758). Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Editio decima, reformata. Laurentius Salvius: Holmiae. ii, 824 pp., available online athttp://www.archive.org/details/systemanaturae01linnuoft [details] [view taxon]

from synonym: Gofas, S.; Afonso, J.P.; Brandào, M. (Ed.). (S.a.). Conchas e Moluscos de Angola = Coquillages et Mollusques d'Angola. [Shells and molluscs of Angola]. Universidade Agostinho / Elf Aquitaine Angola: Angola. 140 pp.

Vernacular
Names

Language	Name
Albanian	medaljoni i përflaktë
Catalan	cauri
Catalan	porcelana
English	brown cowry
French	porcelaine livide
Modern Greek (1453-)	Γουρουνίτσα

Direct child
taxa

Subspecies Luria lurida lurida (Linnaeus, 1758)

Subspecies Luria lurida minima (Dunker, 1853)

Subspecies Luria lurida oceanica (Schilder, 1930)

Subspecies Luria lurida pulchroides Alvarado & Alvarez, 1964

Environment

marine

Distribution

Angola (from synonym)

Azores Exclusive Economic Zone

Benguela (from synonym)

Canaries

Cape Verde

European waters (ERMS scope)

Greek Exclusive Economic Zone

Mediterranean Sea

Portugese Exclusive Economic Zone

Spanish Exclusive Economic Zone

West Africa

Links

To Barcode of Life (3 barcodes)

To Biodiversity Heritage Library (7 publications)

To CLEMAM

To Encyclopedia of Life

To GenBank (2 nucleotides; 1 proteins)

To PESI

To USNM Invertebrate Zoology Mollusca Collection

2012-09-25T08:21:00.002-07:00

cowries

cipree

Kingdom: Animalia

Phylum: Mollusca

Class: Gastropoda

Subclass: Orthogastropoda

Infraclass: Apogastropoda

Superorder: Caenogastropoda

Order: Sorbeoconcha

Suborder: Hypsogastropoda

Infraorder: Littorinimorpha

Superfamily: Cypraeoidea

Family: Cypraeidae

Genus: Cypraea

Species:...

Cowry, also sometimes spelled cowrie, plural always cowries, is the common name for a group of small to large sea snails, marine gastropod mollusks in the family Cypraeidae. The word 'cowry' is often used to refer primarily to the shells of these snails.
(It is worth noting that a few species in the family Ovulidae are also often referred to as cowries, and in the British Isles the local Trivia species Triviidae are sometimes called cowries. These other two families are somewhat closely related to the Cypraeidae.)
Many people find the very rounded, shiny, porcelain-like shells of cowries pleasing to look at and to handle.
Cowries have historically been used as currency in several parts of the world, as well as being used, in the past and present, very extensively in jewelry and for other decorative and ceremonial purposes.
Distribution
Cypraeidae are found in tropical and subtropical oceans and seas worldwide.
Shell description
The shells of cowries are almost always smooth and shiny (a few species have granular shells) and more or less egg-shaped, with a long, narrow, slit-like opening (aperture).
All varieties have a porcelain-like shine (except Hawaii's granulated cowry) and many have colorful patterns. Lengths range from 5 mm (1/5") for some species up to 15 cm (6") for the tiger cowry, Cypraea tigris.Human use
Cowries (esp. Cypraea moneta) were used as a currency in Africa (Ghanaian cedi in Ghana named after cowry shells) and elsewhere, such as in China and India where the shell or copies of the shell were in theory used as a means of exchange. They are also worn as jewelry or otherwise used as ornaments or charms, as they are viewed as symbols of womanhood, fertility, birth and wealth.
Cowry shells are sometimes used in a way similar to dice, e.g., in board games like Pachisi, or in divination (cf. Ifá and the annual customs of Dahomey). A number of shells (6 or 7 in Pachisi) are thrown, with those landing aperture upwards indicating the actual number rolled.
Large cowries have also been used in the recent past as a frame over which sock heels were stretched for darning. The cowry's smooth surface allows the needle to be positioned under the cloth more easily.
The Ojibway aboriginal people in North America used the cowry shells (which they called sacred Megis Shells or whiteshells) in Midewiwin ceremonies, and the Whiteshell Provincial Park in Manitoba, Canada is named after this type of shell. There is some debate about how they traded for or found these shells so far inland, away from the natural sources. Oral stories and birch bark scrolls seem to indicate that they were found in the ground, and/or washed up on the shores of lakes or rivers. The cowry shells so far inland may indicate the use of them by an earlier tribe or group in the area, and an extensive trade network in the ancient past. Petroforms in the Whiteshell Provincial Park may be as old as 8,000 years, and there are questions about how long the shells were used in that area as well.
On the island of Fiji, the golden cowry, Cypraea aurantium, was worn by chieftans as a badge of rank.
Not so many Species
• Cypraea achatidea Sowerby, 1837
• Cypraea acicularis Gmelin, 1791
• Cypraea aenigma Lorenz, 2002
• Cypraea albuginosa Gray, 1825
• Cypraea alexhuberti Lorenz & Huber, 1999
• Cypraea alfredensis Schilder & Schilder, 1929
• Cypraea algoensis Gray, 1825
• Cypraea amphitales Melvill, 1888
• Cypraea androyensis Blocher & Lorenz, 1999
• Cypraea angelicae Clover, 1974
• Cypraea angioyorum Biraghi, 1978
• Cypraea angustata Gmelin, 1791
• Cypraea annettae Dall, 1909
• Cypraea annulus Linnaeus, 1758
• Cypraea arabica Linnaeus, 1758
• Cypraea arabicula Lamarck, 1811
• Cypraea argus Linnaeus, 1758
• Cypraea armeniaca Verco, 1912
• Cypraea artuffeli Jousseaume, 1876
• Cypraea asellus Linnaeus, 1758
• Cypraea aurantium Gmelin, 1791
• Cypraea barbieri Raybaudi, 1986
• Cypraea barclayi Reeve, 1857
• Cypraea beckii Gaskoin, 1836
• Cypraea bernardi Richard, 1974
• Cypraea bistrinotata Schilder & Schilder, 1937
• Cypraea boivinii Kiener, 1843
• Cypraea boucheti Lorenz, 2002
• Cypraea bregeriana Crosse, 1868
• Cypraea brevidentata Sowerby, 1870
• Cypraea broderipii Sowerby, 1832
• Cypraea camelopardalis Perry, 1811
• Cypraea capensis Gray, 1828
• Cypraea capricornica Lorenz, 1989
• Cypraea caputdraconis Melvill, 1888
• Cypraea caputserpentis Linnaeus, 1758
• Cypraea carneola Linnaeus, 1758
• Cypraea castanea Higgins, 1868
• Cypraea catholicorum Schilder, 1938
• Cypraea caurica Linnaeus, 1758
• Cypraea cervica Sowerby II, 1870
• Cypraea cervinetta Kiener, 1843
• Cypraea cervus Linnaeus, 1771
• Cypraea chiapponii Lorenz, 1999
• Cypraea childreni Gray, 1825
• Cypraea chinensis Gmelin, 1791
• Cypraea cicercula Linnaeus, 1758
• Cypraea cinerea Gmelin, 1791
• Cypraea citrina Gray, 1825
• Cypraea clandestina Linnaeus, 1767
• Cypraea cohenae Burgess, 1965
• Cypraea colligata Lorenz, 2002
• Cypraea coloba Melvill, 1888
• Cypraea comptonii Gray, 1847
• Cypraea connelli Liltved, 1983
• Cypraea contaminata Sowerby, 1832
• Cypraea controversa Gray, 1824
• Cypraea coronata Schilder 1930
• Cypraea coxeni Cox, 1873
• Cypraea cribraria Linnaeus, 1758
• Cypraea cruickshanki Kilburn, 1972
• Cypraea cumingii Sowerby, 1832
• Cypraea cylindrica Born, 1778
• Cypraea dayritiana Cate, 1963
• Cypraea decipiens Smith, 1880
• Cypraea declivis Sowerby II, 1870
• Cypraea deforgesi Lorenz, 2002
• Cypraea depressa Gray 1824
• Cypraea diauges Melvill 1888
• Cypraea dillwyni Schilder 1922
• Cypraea diluculum Reeve, 1845
• Cypraea eburnea Barnes, 1824
• Cypraea edentula Gray, 1825
• Cypraea eglantina Duclos, 1833
• Cypraea eludens Raybaudi, 1991
• Cypraea englerti Summers & Burgess, 1965
• Cypraea erosa Linnaeus, 1758
• Cypraea errones Linnaeus, 1758
• Cypraea erythraeensis Hedley, 1837
• Cypraea esontropia Duclos, 1833
• Cypraea exmouthensis Melvill, 1888
• Cypraea exusta Sowerby I, 1832
• Cypraea fallax Smith, 1881
• Cypraea felina Gmelin, 1791
• Cypraea fernadoi Cate, 1969
• Cypraea fimbriata Gmelin, 1791
• Cypraea friendii Gray, 1831
• Cypraea fultoni Sowerby, 1903
• Cypraea fuscodentata Gray, 1825
• Cypraea fuscorubra Shaw, 1909
• Cypraea gangranosa Dillwyn, 1817
• Cypraea garciai Lorenz & Raines, 2001
• Cypraea gaskoinii Reeve, 1846
• Cypraea geographica Schilder, 1933
• Cypraea gilvella Lorenz, 2002
• Cypraea globulus Linnaeus, 1758
• Cypraea goodalli Sowerby I,1832
• Cypraea gracilis Gaskoin, 1849
• Cypraea granulata Pease, 1862
• Cypraea guttata Gmelin, 1791
• Cypraea hammondae Iredale, 1939
• Cypraea hartsmithi Schilder, 1967
• Cypraea helvola Melvill, 1888
• Cypraea histrio Gmelin, 1791
• Cypraea isabella Linnaeus, 1758
• Cypraea isabellamexicana Stearns, 1893
• Cypraea kieneri Hidalgo, 1906
• Cypraea leucodon Broderip, 1828
• Cypraea leviathan Schilder & Schilder, 1937
• Cypraea limacina Lamarck, 1810
• Cypraea lynx Linnaeus, 1758
• Cypraea mappa Linnaeus, 1758
• Cypraea margarita Dillwyn, 1817
• Cypraea mariae Schilder, 1927
• Cypraea mauritiana Linnaeus, 1758
• Cypraea microdon Gray, 1758
• Cypraea minoridens Melvill, 1901
• Cypraea moneta Linnaeus, 1758
• Cypraea mus Linnaeus, 1758
• Cypraea nigropunctata Gray, 1828
• Cypraea nucleus Linnaeus, 1758
• Cypraea ocellata Linnaeus, 1758
• Cypraea onyx Linnaeus, 1758
• Cypraea oweni Linné, 1758
• Cypraea pantherina Solander in Lightfoot, 1786
• Cypraea poraria Linné, 1758
• Cypraea propinqua Garrett, 1879
• Cypraea pulchra Gray, 1824
• Cypraea robertsi Hidalgo, 1906
• Cypraea spadicea Swainson, 1836
• Cypraea spurca Linnaeus, 1758
• Cypraea staphylaea Linnaeus, 1758
• Cypraea stercoraria Linnaeus, 1758
• Cypraea surinamensis G. Perry, 1811
• Cypraea talpa Linnaeus, 1758
• Cypraea testudinaria Linnaeus, 1758
• Cypraea tigris Linnaeus, 1758
• Cypraea vitellus Linnaeus, 1758
• Cypraea vredenburgi Schilder, 1927
• Cypraea walkeri Sowerby I, 1832
• Cypraea xanthodon Sowerby I, 1832
• Cypraea zebra Linnaeus, 1758
• Cypraea ziczac Linnaeus, 1758
• Cypraea zonaria Gmelin, 1791

LE CIPREE
Il termine generico ciprea indica una famiglia di gasteropodi marini (Cypræidæ) che conta, con le sue svariate sottospecie e forme, più di 500 specie viventi distribuite in tutti i mari tropicali del globo.
Habitat elettivo di questo gasteropode è la costa rocciosa o corallina, ricca di anfratti, spugne, alghe ed incrostazioni, nonché molti nascondigli utili a questi animali tipicamente notturni o crepuscolari.
È nota qualche specie che usa frequentare, comunque non stabilmente, habitat sabbiosi o fangosi.
La maggior parte delle specie vive entro i primi 20 metri dalla superficie, con alcune eccezioni che possono arrivare anche 500 metri i profondità.
Caratteristica piuttosto evidente è la conchiglia, globosa, lucida e porcellanacea, con apertura denticolata che si diparte longitudinalmente, alla base.
La peculiare lucidità della conchiglia è dovuta al fatto che quando l'animale è attivo, questa è ricoperta da un sottile strato epiteliale (mantello) che la preserva dagli attacchi incrostanti.
L'ampio mantello, quando è completamente estroflesso, avvolge con i suoi lobi laterali la conchiglia e secerne da apposite ghiandole le sostanze carbonatiche che costruiscono la conchiglia stessa.
Presenta in alcuni casi colore diverso del piede e caratteristiche ornamentazioni di vario genere (papille), ridotte a semplici protuberanze o aventi spesso fogge vistose e colori vivaci.
La crescita della conchiglia avviene attraverso fasi distinte:

Fase oliviforme, con labbro tagliente e nicchio allungato, simile per convergenza a quello delle specie di Oliva (famiglia Olividæ).
Fase bulliforme, più inflata e simile per convergenza ad opistobranchi bullidi (Bullidæ), con protoconca già occultata dall’ultimo grande giro di spira.
In seguito al ripiegamento brusco del labbro a costituire la base labiale, la conchiglia prelude già alla forma definitiva, anche se con denticoli embrionali e colorazione dorsale sfocata.
Con l’accentuarsi dei denti e con la comparsa del disegno definitivo (sovente con macchie e punti) siamo alla fase adulta, con base ispessita e dentatura perfettamente formata.

La radula dei cipreidi appartiene al tipo tenioglosso, costituita da un dente centrale (dente rachidiale), con due serie speculari di denticoli laterali (per la precisione un dente laterale e due denti marginali per lato).
I denti sono costituiti prevalentemente da chitina ed altre proteine.
Tutte le specie sono a sessi separati e depongono numerose uova in anfratti come gusci di conchiglie vuote o sassi capovolti.
La femmina staziona sulle uova per lungo tempo, ricoprendole con il piede per proteggerle.
Dopo la schiusa, si sviluppa una larva planctonica (veliger) che si lascia trasportare dalla corrente.
La durata del veliger può variare da una specie all'altra.
Quelle che hanno stadio larvale prolungato hanno ampie distribuzioni geografiche e limitata variabilità morfologica da un luogo all'altro (come la Monetaria caputserpentis o la Mauritia arabica).
Alcuni generi (Zoila, Umbilia, Cypraeovula, Notocypraea) mancano di stadio larvale e lo sviluppo è diretto, mostrando di conseguenza una maggiore attitudine a dare luogo a varianti localizzate.
Le abitudini alimentari spaziano dal regime prettamente spongivoro del genere Zoila o della mediterranea Luria lurida (L., 1758), ad una dieta mista di alghe, antozoi, ecc.
Il nutrimento viene asportato dal substrato per mezzo della radula, struttura comune a tutti i gasteropodi.