<?xml version="1.0" encoding="UTF-8"?>
<?xml-stylesheet type="text/xsl" media="screen" href="/~d/styles/atom10full.xsl"?><?xml-stylesheet type="text/css" media="screen" href="http://feeds.feedburner.com/~d/styles/itemcontent.css"?><feed xmlns="http://www.w3.org/2005/Atom" xmlns:thr="http://purl.org/syndication/thread/1.0" xmlns:feedburner="http://rssnamespace.org/feedburner/ext/1.0" xml:lang="en" xml:base="http://blog.openwetware.org/freegenes/wp-atom.php">
	<title type="text">Free Genes</title>
	<subtitle type="text">CATGCATGCAAAGACAACGCC</subtitle>

	<updated>2008-07-08T05:53:09Z</updated>
	<generator uri="http://wordpress.org/" version="2.3.1">WordPress</generator>

	<link rel="alternate" type="text/html" href="http://blog.openwetware.org/freegenes" />
	<id>http://blog.openwetware.org/freegenes/feed/atom/</id>
	

			<link rel="self" href="http://feeds.feedburner.com/FreeGenes" type="application/atom+xml" /><entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Build a Lifeform Contest]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/eYk6EbSMlZA/" />
		<id>http://blog.openwetware.org/freegenes/2008/07/07/build-a-lifeform-contest/</id>
		<updated>2008-07-08T05:53:09Z</updated>
		<published>2008-07-08T05:53:09Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Consumer Biotech" /><category scheme="http://blog.openwetware.org/freegenes" term="Garage Biotech" /><category scheme="http://blog.openwetware.org/freegenes" term="Synthetic Biology" />		<summary type="html"><![CDATA[ 			 Sci-fi blog io9 is running a contest to design cool new &#8220;lifeforms&#8221;, from the site:
The important thing to remember is that this contest is about creating cool new lifeforms that are also, in some way, entertaining. So each entry will be judged for plausibility (i.e. whether it is scientifically justifiable), creativity, usefulness, and [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/07/07/build-a-lifeform-contest/">&lt;p&gt;&lt;a href="void(0)" title="spore editor"&gt; 			 &lt;/a&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2008/07/sporeeditor.jpg" title="spore editor"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2008/07/sporeeditor.jpg" alt="spore editor" height="227" width="302" /&gt;&lt;/a&gt;Sci-fi blog io9 is &lt;a href="http://io9.com/5022316/mad-science-contest-build-a-lifeform-and-well-send-you-to-hong-kong-or-give-you-1000"&gt;running a contest&lt;/a&gt; to design cool new &amp;#8220;lifeforms&amp;#8221;, from the site:&lt;/p&gt;
&lt;blockquote&gt;&lt;p&gt;The important thing to remember is that this contest is about creating cool new lifeforms that are also, in some way, entertaining. So each entry will be judged for plausibility (i.e. whether it is scientifically justifiable), creativity, usefulness, and entertainment value.&lt;/p&gt;&lt;/blockquote&gt;
&lt;p&gt;There are two categories and you either win a trip to the Synthetic Biology 4.0 conference in Hong Kong (where you can hear me ranting about &lt;a href="http://blog.openwetware.org/freegenes/2008/03/08/video-talk-physical-reference-standards-for-bioengineering/"&gt;reference standards&lt;/a&gt; or see lots of other &lt;a href="http://sb4.biobricks.org/"&gt;cool stuff&lt;/a&gt;) or 1,000 bucks and a comic rendering of your creature.&lt;/p&gt;
&lt;p&gt;I already listed some of &lt;a href="http://blog.openwetware.org/freegenes/2007/12/26/top-10-new-organisms-of-2007/"&gt;my favorite synthetic &amp;#8220;lifeforms&amp;#8221;&lt;/a&gt; maybe one of those will be submitted - apparently you get bonus points if you&amp;#8217;ve actually implemented your lifeform.&lt;/p&gt;
&lt;p&gt;The judges include &lt;a href="http://web.mit.edu/be/people/endy.htm"&gt;Drew Endy&lt;/a&gt;, &lt;a href="http://rana.lbl.gov/eisen/"&gt;Michael Eisen&lt;/a&gt;, Spore game developer &lt;a href="http://shankel.best.vwh.net/prowiki/jasonwiki/wiki.cgi?FrontPage"&gt;Jason Shankel&lt;/a&gt;, and biology researcher/io9 &amp;#8220;ask a biogeek&amp;#8221; columnist &lt;a href="http://bioeng.berkeley.edu/cv.php?facultyid=3191"&gt;Terry Johnson&lt;/a&gt;.  So get designing!&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/eYk6EbSMlZA" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/07/07/build-a-lifeform-contest/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[OWW Community Blog Launched]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/4dUOgUjG1nA/" />
		<id>http://blog.openwetware.org/freegenes/2008/06/16/oww-community-blog-launched/</id>
		<updated>2008-06-16T19:32:48Z</updated>
		<published>2008-06-16T19:31:16Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Uncategorized" />		<summary type="html"><![CDATA[I got my PhD, which means I should have a little more time to blog now.  Wanted to give a quick pointer to the OpenWetWare community blog that has recently been revamped by Ricard Vidal.  The blog will cover Open Science (both on OpenWetWare and elsewhere) so keep an eye on it if [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/06/16/oww-community-blog-launched/">&lt;p&gt;&lt;a href="http://blog.openwetware.org/community/2008/06/06/owws-jason-kelly-makes-mit-headlines/"&gt;I got my PhD&lt;/a&gt;, which means I should have a little more time to blog now.  Wanted to give a quick pointer to the &lt;a href="http://blog.openwetware.org/community/"&gt;OpenWetWare community blog&lt;/a&gt; that has recently been revamped by &lt;a href="http://openwetware.org/wiki/User:Ricardo_Vidal"&gt;Ricard Vidal&lt;/a&gt;.  The blog will cover Open Science (both on OpenWetWare and elsewhere) so keep an eye on it if you&amp;#8217;re into that sort of thing.  If you&amp;#8217;d like to do a guest post or have written a post on your own blog that you&amp;#8217;d like to have highlighted (the community blog shows up on the &lt;a href="http://openwetware.org/wiki/Main_Page"&gt;OWW homepage&lt;/a&gt;), please email &lt;a href="http://openwetware.org/wiki/User:Ricardo_Vidal"&gt;Ricardo&lt;/a&gt;.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/4dUOgUjG1nA" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/06/16/oww-community-blog-launched/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[The BioEngineering Theme Song!]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/8R-aTP3yp5Q/" />
		<id>http://blog.openwetware.org/freegenes/2008/04/29/the-bioengineering-theme-song/</id>
		<updated>2008-04-29T16:47:21Z</updated>
		<published>2008-04-29T16:47:21Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Uncategorized" />		<summary type="html"><![CDATA[Finally bioengineering has what it&#8217;s long been missing - a theme song!  (scroll down on left side of page).  Thanks to NPR and the  Mammalian Pituitary Band for producing it, and to my colleague Reshma Shetty for contributing the key lyrics &#8220;we&#8217;re building stuff!&#8221;
Song was part of a larger report on our [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/04/29/the-bioengineering-theme-song/">&lt;p&gt;Finally bioengineering has what it&amp;#8217;s long been missing -&lt;a href="http://www.npr.org/templates/story/story.php?storyId=90014997"&gt; &lt;/a&gt;&lt;a href="http://www.npr.org/templates/story/story.php?storyId=90014997"&gt;a theme song!&lt;/a&gt;  (scroll down on left side of page).  Thanks to NPR and the  Mammalian Pituitary Band for producing it, and to my colleague &lt;a href="http://openwetware.org/wiki/User:Reshma_P._Shetty"&gt;Reshma Shetty&lt;/a&gt; for contributing the key lyrics &amp;#8220;we&amp;#8217;re building stuff!&amp;#8221;&lt;/p&gt;
&lt;p&gt;Song was part of a larger report on&lt;a href="http://blog.openwetware.org/sc/2008/04/29/nprs-robert-krulwich-reports-on-bioengineering/"&gt; our iGEM project from 2006&lt;/a&gt; - banana &amp;amp; mint smelling &lt;em&gt;E.coli&lt;/em&gt;.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/8R-aTP3yp5Q" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/04/29/the-bioengineering-theme-song/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Synthetic Biology rant (link)]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/rLwywfRO-UY/" />
		<id>http://blog.openwetware.org/freegenes/2008/04/13/synthetic-biology-rant-link/</id>
		<updated>2008-04-13T19:38:29Z</updated>
		<published>2008-04-13T17:45:51Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Synthetic Biology" />		<summary type="html"><![CDATA[Sorry for the slow posting, starting a blog while writing up my thesis was not my best idea ever.
While i&#8217;m obviously biased on this one, drew just posted a nice rant on The Seven Stones (Nature MSB&#8217;s blog) &#8212; scroll down to the comments.  he tries to maintain a clear definition of synthetic biology, [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/04/13/synthetic-biology-rant-link/">&lt;p&gt;Sorry for the slow posting, starting a blog while writing up my thesis was not my best idea ever.&lt;/p&gt;
&lt;p&gt;While i&amp;#8217;m obviously biased on this one, drew just posted a &lt;a href="http://blog-msb.embo.org/blog/2008/03/synthetic_biology_nsabb_and_cr.html"&gt;nice rant&lt;/a&gt; on The Seven Stones (Nature MSB&amp;#8217;s blog) &amp;#8212; scroll down to the comments.  he tries to maintain a clear definition of synthetic biology, along with notes tossed in about the challenge of convincing editors/scientists that biological engineering should actually contain boring ol&amp;#8217; engineering w/o needing a new scientific discovery tacked on to get published.&lt;/p&gt;
&lt;p&gt;If you&amp;#8217;d like to get incensed about it you can check out the &lt;a href="http://www.nature.com/msb/journal/v3/n1/full/msb4100202.html"&gt;review on synthetic biology by Luis Serrano published in Nature MSB&lt;/a&gt;.  My favorite part:&lt;/p&gt;
&lt;blockquote&gt;&lt;p&gt;Thus, in my opinion, we should consider a more relaxed use of the term engineering in which the emphasis should be placed on the design and simulation of the new functions and properties, rather than on the standardization of parts.&lt;/p&gt;&lt;/blockquote&gt;
&lt;p&gt;I&amp;#8217;d rather not relax engineering for biology&amp;#8217;s sake &amp;#8212;  fundamental engineering principles have allowed us to tame plenty of other substrates, we&amp;#8217;ll get there with biology as well.  As a reminder, this was the transistor in 1948 - this stuff isn&amp;#8217;t supposed to be pretty at the beginning.&lt;/p&gt;
&lt;p&gt;&lt;a href="void(0)" title="firsttransistorgif.jpg"&gt;  			&lt;/a&gt;&lt;a href="void(0)" title="firsttransistorgif.jpg"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2008/04/firsttransistorgif.jpg" height="244" width="244" /&gt;&lt;/a&gt;&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/rLwywfRO-UY" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/04/13/synthetic-biology-rant-link/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[moo&#8230;  MIT Biological Engineering t-shirts]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/_KFyjp54kpQ/" />
		<id>http://blog.openwetware.org/freegenes/2008/03/17/moo-mit-biological-engineering-shirts/</id>
		<updated>2008-03-22T22:05:17Z</updated>
		<published>2008-03-18T04:51:59Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Synthetic Biology" />		<summary type="html"><![CDATA[
I have to give credit to the MIT Biological Engineering (Course 20) undergrads, who came up with a classic shirt(s).    Seemed like the turtle was the clear favorite at the sale today.  This thing is sure to become a permanent MIT feature (rivaling &#8220;six hertz six bytes&#8221;, no question about it).


Update: [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/03/17/moo-mit-biological-engineering-shirts/">&lt;p&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2008/03/mootutle.JPG" title="Direct link to file"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2008/03/mootutle.JPG" alt="mootutle.JPG" height="118" width="228" /&gt;&lt;/a&gt;&lt;/p&gt;
&lt;p&gt;I have to give credit to the MIT Biological Engineering (Course 20) undergrads, who came up with a classic shirt(s).    Seemed like the turtle was the clear favorite at the sale today.  This thing is sure to become a permanent MIT feature (rivaling &amp;#8220;six hertz six bytes&amp;#8221;, no question about it).&lt;/p&gt;
&lt;p&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2008/03/mit-other-designs.JPG" title="Direct link to file"&gt;&lt;/a&gt;&lt;/p&gt;
&lt;p&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2008/03/mit-other-designs.JPG" title="Direct link to file"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2008/03/mit-other-designs.JPG" alt="mit-other-designs.JPG" align="left" height="287" width="436" /&gt;&lt;/a&gt;&lt;/p&gt;
&lt;p&gt;&lt;strong&gt;Update&lt;/strong&gt;: The BE Undergraduate Board has posted &lt;a href="http://openwetware.org/wiki/Undergrad_BE_Board:T-shirt_Study_Break"&gt;better pictures of the shirts&lt;/a&gt;.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/_KFyjp54kpQ" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/03/17/moo-mit-biological-engineering-shirts/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Video Talk: Physical Reference Standards for Bioengineering]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/0Ywn5OlrxEE/" />
		<id>http://blog.openwetware.org/freegenes/2008/03/08/video-talk-physical-reference-standards-for-bioengineering/</id>
		<updated>2008-03-09T03:52:08Z</updated>
		<published>2008-03-09T03:44:39Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Scientific Communication" /><category scheme="http://blog.openwetware.org/freegenes" term="Synthetic Biology" />		<summary type="html"><![CDATA[I “gave a talk” at the Biobrick foundation technical standards workshop last weekend.  Gave a talk is in quotes since I had a previous commitment and couldn’t be there in person.  Instead I made a screencast/video presentation that was sent out to the BBF mailing list before the conference and then replayed during [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/03/08/video-talk-physical-reference-standards-for-bioengineering/">&lt;p&gt;I “gave a talk” at the &lt;a href="http://bbf.openwetware.org/"&gt;Biobrick foundation&lt;/a&gt; technical standards &lt;a href="http://bbf.openwetware.org/Workshop2.html"&gt;workshop&lt;/a&gt; last weekend.  Gave a talk is in quotes since I had a previous commitment and couldn’t be there in person.  Instead I made a screencast/video presentation that was sent out to the BBF mailing list before the conference and then replayed during the presentations at the conference.  The talk was about a simple measurement kit for BioBrick promoters and RBSs and about the need for physical reference standards in biological engineering.  The video is below, and probably gets things across more clearly then I could in a post – so take a look if you are interested in the topic.&lt;/p&gt;
&lt;p&gt;&lt;object type="application/x-shockwave-flash" data="http://video.google.com/googleplayer.swf?docId=3783852973289336417&amp;amp;hl" width="425" height="350" wmode="transparent"&gt;&lt;param name="movie" value="http://video.google.com/googleplayer.swf?docId=3783852973289336417&amp;amp;hl" /&gt;&lt;/object&gt;&lt;/p&gt;
&lt;p&gt;Wanted to make a quick rant, but before that I should say that the BBF workshop had breakout sessions, lots of pre- and post-conference email discussion, and sounds like it made good use of dragging people to the same locale.&lt;/p&gt;
&lt;p&gt;With that out of the way, I personally think the whole get 100 people in a room and have them sit in silence listening to a talk is an enormous waste of time.  If you are trying to get people to collaborate by being in physical proximity there are better formats (&lt;a href="http://en.wikipedia.org/wiki/Foo_Camp"&gt;foo camp&lt;/a&gt; / &lt;a href="http://en.wikipedia.org/wiki/Unconference"&gt;unconferences&lt;/a&gt; come to mind).  It’s also a bad deal for the busy presenting scientist who has to take a couple days out of her schedule to travel to the talk location.&lt;/p&gt;
&lt;p&gt;A better approach might be to mail out a video presentation from a scientist to an email list (say the MIT bioengineering dept list), and then have the presenter on the hook to reply to the first 20 emails received from the talk viewers.  The presenter would replace 2 travel days with a 2 hour email session and the talk viewers would get much more detailed Q&amp;amp;A and could watch the talk at their leisure.  The Q&amp;amp;A could even be compiled and emailed to the mailing list afterwards, what a helpful resource that would be!&lt;/p&gt;
&lt;p&gt;In addition, talks would be higher quality as they could be clipped, edited, and retaken.  My talk might not be a great example as I cranked it out the night before heading out on a trip, but I did do a retake of the second half and clipped it in. (try to do that during an in-person talk!)&lt;/p&gt;
&lt;p&gt;Overall, I liked the experience of the video talk, and it seems like it wouldn’t be hard to make this standard operating procedure for many talks.  Would love to hear your thoughts on this (or on physical ref standards for BE) in the comments.&lt;/p&gt;
&lt;p&gt;p.s. I used camtasia studio to make the talk, in case you want to make your own.  There are probably free options out there too.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/0Ywn5OlrxEE" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/03/08/video-talk-physical-reference-standards-for-bioengineering/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Blue Roses]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/QIu9Xqy4h0E/" />
		<id>http://blog.openwetware.org/freegenes/2008/02/06/blue-roses/</id>
		<updated>2008-02-06T07:09:24Z</updated>
		<published>2008-02-06T07:09:24Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Consumer Biotech" />		<summary type="html"><![CDATA[A new consumer biotech product that has been in the works since the early 90s was announced on Monday - a rose genetically engineered to be blue (looks purple to me).  A Japanese company, Suntory Ltd., is distributing the flowers, however the science was mostly done at Florigene.  Unique house plants seem like an early [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/02/06/blue-roses/">&lt;p&gt;A new consumer biotech product that has been in the works since the early 90s was announced on Monday - a rose genetically engineered to be &lt;a href="http://www.physorg.com/news121326878.html"&gt;blue&lt;/a&gt; (looks purple to me).  A Japanese company, Suntory Ltd., is distributing the flowers, however the science was mostly done at &lt;a href="http://www.florigene.com.au/"&gt;Florigene&lt;/a&gt;.  Unique house plants seem like an early application area for consumer biotech - genes for new pigments and drought-resistance (my plants could use this!) are obvious alterations.  Anything else on your wishlist?  I&amp;#8217;d vote for bonsai trees that didn&amp;#8217;t require clipping to stay small.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/QIu9Xqy4h0E" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/02/06/blue-roses/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Consensus Protocols]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/E_9575zvUmo/" />
		<id>http://blog.openwetware.org/freegenes/2008/02/05/consensus-protocols/</id>
		<updated>2008-03-22T22:06:38Z</updated>
		<published>2008-02-05T07:38:31Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Uncategorized" />		<summary type="html"><![CDATA[There is an excellent review just out in Nature Methods describing a &#8216;consensus protocol&#8217; for protein production and purification.  Here it is (fair use, I say!) :

Obtain the cDNA by amplifying either genomic DNA (prokaryotic genes, or eukaryotic genes with no introns) or full-length, sequence-verified cDNAs (eukaryotes) or by total gene synthesis.
Use ligation-independent cloning [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2008/02/05/consensus-protocols/">&lt;p&gt;There is an &lt;a href="http://www.ncbi.nlm.nih.gov/pubmed/18235434?ordinalpos=1&amp;amp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum"&gt;excellent review just out in Nature Methods&lt;/a&gt; describing a &amp;#8216;consensus protocol&amp;#8217; for protein production and purification.  Here it is (fair use, I say!) :&lt;/p&gt;
&lt;ul&gt;
&lt;li&gt;Obtain the cDNA by amplifying either genomic DNA (prokaryotic genes, or eukaryotic genes with no introns) or full-length, sequence-verified cDNAs (eukaryotes) or by total gene synthesis.&lt;/li&gt;
&lt;li&gt;Use ligation-independent cloning (LIC) to clone the full-length cDNA (or the fragment of interest) into an E. coli expression vector.&lt;/li&gt;
&lt;li&gt;Use T7 RNA polymerase–driven expression and an N-terminal oligohistidine tag (include a cleavage site for a sequence-specific protease to enable removal of the tag).&lt;/li&gt;
&lt;li&gt;Express the protein in a derivative of the E. coli BL21(DE3) strain, with induction at low temperature (15–25 °C) in rich medium and with good aeration. If expressing proteins from organisms that have codon biases differing from those used by E. coli, use a strain supplemented with the appropriate tRNA genes.&lt;/li&gt;
&lt;li&gt;Solubilize and purify the protein in a well-buffered solution containing an ionic strength equivalent to 300–500 mM of a monovalent salt, such as NaCl.&lt;/li&gt;
&lt;li&gt;Use immobilized metal affinity chromatography (IMAC) as the initial purification step.&lt;/li&gt;
&lt;li&gt;If additional purification is required, use size-exclusion chromatography (gel filtration). If necessary, use ion exchange chromatography as a final ‘polishing’ step.&lt;/li&gt;
&lt;li&gt;The affinity tag may be removed to minimize non-native sequences in the recombinant protein and to achieve further purification. Use a recombinant, hexahistidine-tagged protease and reapply the sample to IMAC column to remove the protease and any cellular proteins that bound to the metal affinity resin.&lt;/li&gt;
&lt;/ul&gt;
&lt;p&gt;The paper is excellent and I recommend giving it a read, but the protocol above is the real take-away.  Though it&amp;#8217;s offered with the caveat: &amp;#8220;although the protocols for the ‘first attempt’ described here have proven to be optimal for the broadest range of proteins, in any individual case, the methods will fail more often than they succeed.&amp;#8221; &amp;#8230;And that&amp;#8217;s why I love biology, fun times.&lt;/p&gt;
&lt;p&gt;We&amp;#8217;ve also explored &lt;a href="http://openwetware.org/wiki/Help:Consensus_protocol"&gt;consensus protocols&lt;/a&gt; on OpenWetWare, the best example being &lt;a href="http://openwetware.org/wiki/DNA_ligation"&gt;DNA ligation&lt;/a&gt;.   &lt;a href="http://openwetware.org/wiki/Protocols"&gt;OpenWetWare protocols&lt;/a&gt; does an excellent job accumulating many &lt;a href="http://openwetware.org/wiki/DNA_ligation#Specific_protocols"&gt;different variants&lt;/a&gt; of protocols as practiced by different labs.  However, figuring out the best way to encourage synthesis of those protocols into &amp;#8216;consensus protocols&amp;#8217; is an important challenge for OWW going forward.   Any thoughts are welcome.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/E_9575zvUmo" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2008/02/05/consensus-protocols/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Top 10 New Organisms of 2007]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/8Ox5k1g9XOQ/" />
		<id>http://blog.openwetware.org/freegenes/2007/12/26/top-10-new-organisms-of-2007/</id>
		<updated>2007-12-26T21:06:26Z</updated>
		<published>2007-12-26T21:04:27Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Uncategorized" />		<summary type="html"><![CDATA[Wired lists the Top 10 New Organisms of 2007.  These aren&#8217;t newly discovered organisms, but rather newly-engineered ones.  Much more interesting then discovering some long-eared rodent &#8212; though not as cute, I guess.  There&#8217;s even mention of one of the 2007 iGEM projects, the University of Alberta &#8220;butanerds&#8220;, who engineered a butanol-producing [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2007/12/26/top-10-new-organisms-of-2007/">&lt;p&gt;Wired lists the &lt;a href="http://www.wired.com/science/discoveries/news/2007/12/YE_10_organisms" title="Wired top 10 organisms"&gt;Top 10 New Organisms of 2007&lt;/a&gt;.  These aren&amp;#8217;t newly &lt;em&gt;discovered&lt;/em&gt; organisms, but rather newly-engineered ones.  Much more interesting then discovering some &lt;a href="http://www.guardian.co.uk/environment/2007/dec/10/conservation.sciencenews"&gt;long-eared rodent&lt;/a&gt; &amp;#8212; though not as cute, I guess.  There&amp;#8217;s even mention of one of the 2007 iGEM projects, the University of Alberta &amp;#8220;&lt;a href="http://parts.mit.edu/igem07/index.php/Alberta" title="butanerds"&gt;butanerds&lt;/a&gt;&amp;#8220;, who engineered a butanol-producing &lt;em&gt;E.coli&lt;/em&gt;.  Hopefully this list becomes a yearly Wired feature.  Not from this year, but I always thought &lt;a href="http://www.csmonitor.com/2004/0219/p11s01-stss.html"&gt;these were cool&lt;/a&gt; and of course MIT&amp;#8217;s &lt;a href="http://www.technologyreview.com/article/18338/"&gt;Eau d&amp;#8217;ecoli&lt;/a&gt; (though I&amp;#8217;m biased on that one).  Put your favorite new organisms in the comments.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/8Ox5k1g9XOQ" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2007/12/26/top-10-new-organisms-of-2007/</feedburner:origLink></entry>
		<entry>
		<author>
			<name>Jason</name>
						<uri>http://openwetware.org/wiki/User:Jason_R._Kelly</uri>
					</author>
		<title type="html"><![CDATA[Video @ the bench]]></title>
		<link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/FreeGenes/~3/UXqnzI2wPMo/" />
		<id>http://blog.openwetware.org/freegenes/2007/12/16/video-the-bench/</id>
		<updated>2007-12-17T00:44:46Z</updated>
		<published>2007-12-17T00:34:41Z</published>
		<category scheme="http://blog.openwetware.org/freegenes" term="Garage Biotech" /><category scheme="http://blog.openwetware.org/freegenes" term="Synthetic Biology" />		<summary type="html"><![CDATA[I saw the movie I Am Legend this weekend, and although it wasn’t exactly a ringing endorsement of synthetic biology (re-engineering measles is a bad idea, apparently) Will Smith’s character did have a slick lab in his basement.  Good to see a little Garage Biotech in action.
One component of the lab they made heavy [...]]]></summary>
		<content type="html" xml:base="http://blog.openwetware.org/freegenes/2007/12/16/video-the-bench/">&lt;p&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2007/12/i_am_legend_teaser.jpg" title="Direct link to file"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2007/12/i_am_legend_teaser.jpg" alt="IAmLegendPoster" height="409" width="286" /&gt;&lt;/a&gt;I saw the movie &lt;a href="http://en.wikipedia.org/wiki/I_am_legend"&gt;I Am Legend&lt;/a&gt; this weekend, and although it wasn’t exactly a ringing endorsement of synthetic biology (re-engineering measles is a bad idea, apparently) Will Smith’s character did have a slick lab in his basement.  Good to see a little &lt;a href="http://www.wired.com/wired/archive/13.05/view.html?pg=2?tw=wn_tophead_5"&gt;Garage&lt;/a&gt; &lt;a href="http://makezine.com/07/graft/"&gt;Biotech&lt;/a&gt; in action.&lt;/p&gt;
&lt;p&gt;One component of the lab they made heavy use of was a video lab notebook.  I assume this was done since Will Smith scribbling in a paper lab notebook wouldn’t have had quite the same cinematic effect.  However, getting video into the lab will be important for democratizing biological engineering.  A lot of the barriers to would be bio-hackers lay in the difficulty of learning biological protocols from texts.  New graduate students benefit enormously from hands-on learning with a mentor in their early days in lab, and without this visual teaching getting booted up in the lab is extremely frustrating.&lt;/p&gt;
&lt;p&gt;New science video sites like &lt;a href="http://www.jove.com/"&gt;Jove&lt;/a&gt; and &lt;a href="http://www.scivee.tv/"&gt;Scivee.tv&lt;/a&gt; suffer because labs aren’t really equipped to capture video.  So at best you’ll be able to disseminate talks, but video protocols are going to be very hard to pull off.  I’ve been thinking about video lab notebooks / protocols since &lt;a href="http://knight.openwetware.org/"&gt;Tom Knight&lt;/a&gt; brought up some clever ways you might set your bench up to accommodate video capture (cameras in various spots, foot-petal control, and smart ways to handle the data).  A more nerdy looking way to do this (no offense to Will Bosworth who used to work around the Endy Lab) is the head-mounted video camera &lt;a href="http://saulgriffith.com/Make/Make07.pdf"&gt;described by Saul Griffith&lt;/a&gt; in Make magazine.&lt;/p&gt;
&lt;p&gt;&lt;a href="http://blog.openwetware.org/freegenes/files/2007/12/will.JPG" title="Direct link to file"&gt;&lt;img src="http://blog.openwetware.org/freegenes/files/2007/12/will.JPG" alt="will.JPG" align="left" height="234" width="345" /&gt;&lt;/a&gt;&lt;/p&gt;
&lt;p&gt;There are also some &lt;a href="http://www.axis.com/products/cam_207w/index.htm"&gt;wireless web-cameras&lt;/a&gt; that might make your setup cheaper.  If anyone is doing a good job of taking video at the bench, please let me know about your setup.&lt;/p&gt;
&lt;img src="http://feeds.feedburner.com/~r/FreeGenes/~4/UXqnzI2wPMo" height="1" width="1"/&gt;</content>
	<feedburner:origLink>http://blog.openwetware.org/freegenes/2007/12/16/video-the-bench/</feedburner:origLink></entry>
	</feed>
