Low Cost
1, freezerworks, windows
2, Progeny LIMS
3, eLab.
4, SampleWare LIMS, $1500 from Micronic
5, FreezerPro from Ruro, $1500

1, Mix 3 g of diatomaceous earth with 30 ml of sterile milliQ water

2, Let suspensionto settle for 2 to 3 hours, discard upper liquid phase discarded.

3, Resuspend the settled particulate matter in 6.0 ml of sterile milliQ water. This yield stock solution of approximately 150 mg/ml (w/v density of 1.130 to 1.150 g per ml).

4, Add 2.0 ml suspension to 50 ml of chaotropic binding solution (7 M guanidine HCl in 50 mM Tris;
20 mM EDTA; pH 7.0, or 6 M guanidine thiocyanate in 50 mM Tris; 20 mM EDTA; pH 7.0)

Preparation of silica particles.

Silica powder
1, GLASSMILK from BIO101
2, Celite from Sigma/Aldrich
3, 325 mesh powdered flint glass fines from Cutter Ceramics, Beltsville, MD Beltsville, MD, USA.

use the same method as diatomaceous earth for preparing silica powders.

To further remove impurity, add equal vol of concentrated nitric acid and boil in a fume hood, cool down, spin down glass powder, wash extensively with TE buffer and resuspend to give a final concentration of 10 mg/ml. The binding solution should be sodium iodide 908 g/l saturated with sodium sulfte 15 g/l in either 20 mM Tris pH 7.5, or 6 M sodium perchlorate, 50 mM Tris, 10 mM EDTA pH 8.0.

MiniPrep

1. Grow E. coli cells in medium with antibiotics.
2. Spin down cells
3. Resuspend the bacterial cell pellet in 100 ul P1 (25 mM Tris, 10 mM EDTA, 100 ug ml RNaseA, pH 8.0).
4. Add 200 ul of P2 (0.15 M NaOH, 1.0% SDS), mix by inverting.
5. Add 150 ul of N3 (3 M sodium acetate pH 4.8), mix by inverting.
6. Spin 2 X 3.5 min at 4 oC.
7. Mix supernatant with 1.0 ml binding solution, transfer to spin column.
8. Spin
9. Wash metrix twice with 0.35 ml of PE (0 mM Tris; 100 mM NaCl; 2.5 mM EDTA; 55% (v/v) Ethanol; pH 7.5).
10. Allow the packed matrix to completely dry by spinning for another 1~5 minutes.
11, Add 50 ul EB or water, spin to elute DNA.

    * 0.5% (w/v) yeast extract
    * 2% (w/v) tryptone
    * 10 mM NaCl
    * 2.5 mM KCl
    * 20 mM MgSO4
Per liter:

    * 5 g yeast extract
    * 20 g tryptone
    * 0.584 g NaCl
    * 0.186 g KCl
    * 2.4 g MgSO4
Note: Some formulations of SOB use 10 mM MgCl2 and 10 mM MgSO4 instead of 20 mM MgSO4.
SOB medium is also available dry premixed from Difco, 0443-17.
Adjust to pH 7.5 prior to use. This requires approximately 25 ml of 1M NaOH per liter

SOC   

  * SOB with 20 mM glucose

CCMB80 buffer

• 10 mM KOAc pH 7.0 (10 ml of a 1M stock/L)

• 80 mM CaCl₂.2H₂O (11.8 g/L)
• 20 mM MnCl₂.4H₂O (4.0 g/L)
• 10 mM MgCl₂.6H₂O (2.0 g/L)
• 10% glycerol (100 ml/L)
• adjust pH DOWN to 6.4 with 0.1N HCl if necessary
  
  • adjusting pH up will precipitate manganese dioxide from Mn containing solutions.
• sterile filter and store at 4°C
• slight dark precipitate appears not to affect its function

Procedure

Preparing glassware and media

Eliminating detergent

Do not wash glassware with soap, rinse it with H2O and autoclave.

Prechill plasticware and glassware

Prechill centrifuge tubes and screw cap tubes before use.

Preparing seed stocks

• Streak TOP10 cells on an SOB plate and grow for single colonies at room temperatur
• Pick single colonies into 2 ml of SOB medium and shake overnight at room temperature 25 oC
• Add glycerol to 15%
• Aliquot 1 ml samples to Nunc cryotubes
• Store in a -80°C freezer.

Preparing competent cells

• Inoculate 250 ml of SOB medium with 1 ml vial of seed stock and grow at 20°C to an OD600 of 0.3
  
  • This takes approximately 16 hours.
  • Controlling the temperature makes this a more reproducible process, but is not essential.
  • Room temperature will work. You can adjust this temperature somewhat to fit your schedule
  • Aim for lower, not higher OD if you can’t hit this mark
• Centrifuge at 3000g at 4°C for 10 minutes in a flat bottom centrifuge bottle.
  
  • Flat bottom centrifuge tubes make the fragile cells much easier to resuspend
  • It is often easier to resuspend pellets by mixing before adding large amounts of buffer
• Gently resuspend in 80 ml of ice cold CCMB80 buffer
  
  • sometimes this is less than completely gentle. It still works.
• Incubate on ice 20 minutes
• Centrifuge again at 4°C and resuspend in 10 ml of ice cold CCMB80 buffer.
• Test OD of a mixture of 200 μl SOC and 50 μl of the resuspended cells.
• Add chilled CCMB80 to yield a final OD of 1.0-1.5 in this test.
• Incubate on ice for 20 minutes
• Aliquot to chilled screw top 2 ml vials or 50 μl into chilled microtiter plates
• Store at -80°C indefinitely.
  
  • Flash freezing does not appear to be necessary
• Test competence (see below)
• Thawing and refreezing partially used cell aliquots dramatically reduces transformation efficiency by about 3x the first time, and about 6x total after several freeze/thaw cycles.

Measurement of competence

• Transform 50 μl of cells with 1 μl of standard pUC19 plasmid (Invitrogen)
  
  • This is at 10 pg/μl or 10^-5 μg/μl
  • This can be made by diluting 1 μl of NEB pUC19 plasmid (1 μg/μl, NEB part number N3401S) into 100 ml of TE
• Hold on ice 0.5 hours
• Heat shock 60 sec at 42C
• Add 250 μl SOC
• Incubate at 37 C for 1 hour in 2 ml centrifuge tubes rotated
  
  • using 2ml centrifuge tubes for transformation and regrowth works well because the small volumes flow well when rotated, increasing aeration.
  • For our plasmids (pSB1AC3, pSB1AT3) which are chloramphenicol and tetracycline resistant, we find growing for 2 hours yields many more colonies
  • Ampicillin and kanamycin appear to do fine with 1 hour growth
• Plate 20 μl on AMP plates using sterile 3.5 mm glass beads
  
  • Good cells should yield around 100 – 400 colonies
  • Transformation efficiency is (dilution factor=15) x colony count x 10⁵/µgDNA
  • We expect that the transformation efficiency should be between 5×10⁸ and 5×10⁹
    cfu/µgDNA

5x Ligation Adjustment Buffer

• Intended to be mixed with ligation reactions to adjust buffer composition to be near the CCMB80 buffer
• KOAc 40 mM (40 ml/liter of 1 M KOAc solution, pH 7.0)
• CaCl₂ 400 mM (200 ml/l of a 2 M solution)
• MnCl₂ 100 mM (100 ml/l of a 1 M solution)
• Glycerol 46.8% (468 ml/liter)
• pH adjustment with 2.3% of a 10% acetic acid solution (12.8ml/liter)
  
  • Previous protocol indicated amount of acetic acid added should be 23 ml/liter but that amount was found to be 2X too much per tests on 1.23.07
• water to 1 liter
• autoclave or sterile filter
• Test pH adjustment by mixing 4 parts ligation buffer + 1 part 5x ligation adjustment buffer and checking pH to be 6.3 – 6.5
• Use of the ligation adjustment buffer is optional.

References

US Patent 6,709,852; 6,855,494; 6,960,464

AGG and AGA for arginine
AUA for isoleucine
CUA for leucine
GGA for glycine
CCC for proline

Forward oligo:
5′ CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3′

Reverse oligo:
5′ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3′

For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:

Forward oligo:

5′ CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG 3′

Reverse oligo:

5′ AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT 3′

For eGFP:
Age1 Xho1 (loop) EcoR1
F: 5' CCGG TACAACAGCCACAACGTCTAT CTCGAG ATAGACGTTGTGGCTGTTGTA TTTTT G 3'
R: 3' C ATGTTGTCGGTGTTGCAGATA GAGCTC TATCTGCAACACCGACAACAT AAAAA CTTAA 5'
R: 5' AATTCAAAAATACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTAC 3'

Another example:

AgeI Sense Loop (XhoI) Antisense Termination
F: 5’ CCGG CCAGACCACTACTGAATATAA CTCGAG TTATATTCAGTAGTGGTCTGG TTTTT 3’
compl 3' GGCC GGTCTGGTGATGACTTATATT GAGCTC AATATAAGTCATCACCAGACC AAAAA 5'

Oligos for making shRNA:
F: 5’ CCGG CCAGACCACTACTGAATATAA CTCGAG TTATATTCAGTAGTGGTCTGG TTTTT 3’
R: 5’AATT AAAAACCAGACCACTACTGAATATAACTCGAGTTATATTCAGTAGTGGTCTGG 3’

*5 µl of 10x T4 ligase buffer (NEB)
*5 µl of 10x Ampligase buffer (Epicentre Biotechnology)
*0.67 µM of TmPrime-optimized oligonucleotides for target gene (phosphorylated using 20 U of T4 polynucleotide kinase, NEB), and 20 U of Ampligase (Epicentre Biotechnology)
* H2O to 5 µl.

LCR:
37°C for 4 hrs, denatured at 95°C for 3 min, ramped to 60°C at 0.1°C/s for annealing, and incubated at 60°C for 2–8 hrs.

PCR mix:
*2 µl of LCR product
*0.4 µM of outer primers
*2 mM of MgSO4
*500 µM of each dNTP (Stratagene)
*500 µg/ml of bovine serum albumin
*1 U of KOD Hot Start (Novagen)
*1x PCR buffer (Novagen)
*H2O to 50 µl.

PCR:
–2 min of initial denaturation at 95°C
–30 cycles of:
*95°C for 5 sec
*55°C for 30 sec
*72°C for 30 sec
–Last Extension at 72°C for 10 min.

2 DNAWorks: http://helixweb.nih.gov/dnaworks/
Accepted annealing temperature: 58–70 °C
Design conditions: Oligo size: 50 nt Random; Annealing temp: 65 +/- 1 °C; No gaps are allowed in assembled gene

3 GeneDesign: http://baderlab.bme.jhu.edu/gd/
Accepted annealing temperature: no information
Users can not specify the oligonucleotide concentration and PCR buffer conditions.
Software does not provide the information of melting temperature derivation of oligonucleotide set.
Design conditions: Target oligo length: 60 bp; Chunk overlap 20 bp
Oligonucleotide design may fail when the sequence of consecutive oligonucleotides collides.

4 Gene2oligo: http://berry.engin.umich.edu/gene2oligo/
Accepted annealing temperature: no information
Design condition: Oligo Tm priority with of Tm of 55 or 65 +/- 4 °C
Oligonucleotide design may fail to converge.

5 Assembly PCR Oligo Maker: http://startrek.ccs.yorku.ca/~pjohnson/AssemblyPCRoligomaker.html
Accepted assembly (annealing) temperature: 50–60 °C
Accepted oligonucleotide length: 40–70 nt
Design condition: Maximum oligonucleotide length: 70 nt
Software does not provide the information of melting temperature derivation of oligonucleotide set.

2, Lithium Acetate Buffer – 5 mM lithium acetate, for separating DNA fragments >3 kb. (restriction digestion).

3, Lithium Borate Buffer – 1 mM lithium boric acid (lithium hydroxide pH buffered to pH ~8.5 with boric acid). For small DNA fragments (PCR products). Lithium Borate Buffer has better resolution than Sodium Borate Buffer for small DNA fragments.

Run gels at 200~ 300 V.

Membrane incubation
  Use a volume that will cover the membrane. Incubate at room temperature for 5-10 minutes.
  Discard buffer.
  5-10 minutes fresh stripping buffer.
  Discard buffer.
  10 minutes PBS
  10 minutes PBS
  5 minutes TBST
  5 minutes TBST

Harsh stripping
Prepare buffer and strip membranes under a fumehood.
Buffer, 0.1 litre
20 ml SDS 10%
12.5 ml Tris HCl pH 6.8 0.5 M
67.5 ml ultra pure water
0.8 ml ß-mercaptoethanol

Procedure
1. Warm the buffer to 50° C.
2. Add the buffer to a small plastic box which has a tight lid. Use a volume that will cover the membrane.
3. Add the membrane. Incubate at 50° for up to 45 minutes with some agitation.
4. Dispose of the solution as required for ß-mercaptoethanol based buffers.
5. Rinse the membrane under running water tap for 1-2 hours.
6. Traces of ß-mercaptoethanol will damage the antibodies. Wash extensively for 5 minutes in TBST.

    25μL total reaction volume:

    * 2.5 μL of 10X Taq ligase buffer.
    * 0.5 μL 100mM ATP.
    * 1 μL 25mM each dNTP.
    * X μL (50-100 ng) of dsDNA template.
    * X μL of each oligonucleotide primer, e.g., 0.4 μL of 10μM each primer.
    * 1 μL of 10 mM dNTP mix.
    * Add H2O to a final volume of 22 μL.
    * 1 μL of PfuTurbo DNA polymerase (2.5 U/μL).
    * 1 μL of Taq Ligase.
    * 1 μL of T4 PNK.

   IV. PCR
         1, 37°C for 30 min (T4 PNK step)
         2, 95°C for 3 min
         25 cycles of step 3 to 5:
         3, 95°C for 1 min
         4, 55°C for 1 min
         5, 65°C for 2 min/kb of plasmid length minimum (is optimal temperature for Taq ligase)
         6.  65°C for 5 min
   V. Cool the reaction to <=37°C
   VI. Add 1μL DpnI restriction enzyme.
   VII. Incubate 1 to 6 hours at 37°C.
   VIII. Purify PCR product using Qiagen PCR purification kit and transform Top10 competent cells.

Ligation:
10 ul DNA mix (insert +  vector)
10 ul 2X ligase buffer
0.7 ul Ligase from NEB

Mix and ligate at RT for 5 min.
Transform bacteria

Ref: http://www.neb.com/nebecomm/products/productm2200.asp