<?xml version="1.0" encoding="UTF-8"?>
<?xml-stylesheet type="text/xsl" media="screen" href="/~d/styles/atom10full.xsl"?><?xml-stylesheet type="text/css" media="screen" href="http://feeds.feedburner.com/~d/styles/itemcontent.css"?><feed xmlns="http://www.w3.org/2005/Atom" xmlns:openSearch="http://a9.com/-/spec/opensearch/1.1/" xmlns:blogger="http://schemas.google.com/blogger/2008" xmlns:georss="http://www.georss.org/georss" xmlns:gd="http://schemas.google.com/g/2005" xmlns:thr="http://purl.org/syndication/thread/1.0" xmlns:feedburner="http://rssnamespace.org/feedburner/ext/1.0" gd:etag="W/&quot;DUUBR3s9eSp7ImA9WhFTFU4.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690</id><updated>2013-06-06T12:47:36.561-04:00</updated><category term="beginnings" /><category term="education" /><category term="ga" /><category term="media" /><category term="geek moments" /><category term="TV" /><category term="MySQL" /><category term="finance" /><category term="global warming" /><category term="XBRL" /><category term="UD" /><category term="comics" /><category term="WordPress" /><category term="hybrid" /><category term="douglas axe" /><category term="dembski" /><category term="music" /><category term="folding" /><category term="origin of life" /><category term="evolution" /><category term="cirque" /><category term="ecj" /><category term="sf" /><category term="intelligent design" /><category term="PHP" /><category term="movie" /><category term="regulation" /><category term="nj" /><category term="OOL" /><category term="mystery" /><category term="Granville Sewell" /><category term="Barham" /><category term="anime" /><category term="SLoT" /><category term="fun" /><category term="eclipse" /><category term="Apache" /><category term="Hurricane Sandy" /><category term="review" /><category term="dance" /><category term="WAMP" /><category term="Magic" /><title>Invisible Hand</title><subtitle type="html">Invisible Hand is a blog about whatever I find interesting in the world, a lot of which happens to revolve around how simple rules create complex phenomena.</subtitle><link rel="http://schemas.google.com/g/2005#feed" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/posts/default" /><link rel="alternate" type="text/html" href="http://dvunkannon.blogspot.com/" /><link rel="next" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default?start-index=26&amp;max-results=25&amp;redirect=false&amp;v=2" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><generator version="7.00" uri="http://www.blogger.com">Blogger</generator><openSearch:totalResults>113</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>25</openSearch:itemsPerPage><atom10:link xmlns:atom10="http://www.w3.org/2005/Atom" rel="self" type="application/atom+xml" href="http://feeds.feedburner.com/blogspot/gfWNB" /><feedburner:info uri="blogspot/gfwnb" /><atom10:link xmlns:atom10="http://www.w3.org/2005/Atom" rel="hub" href="http://pubsubhubbub.appspot.com/" /><entry gd:etag="W/&quot;DEQHQ3wyeSp7ImA9WhBaEUk.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-4104041943976184899</id><published>2013-05-21T10:25:00.002-04:00</published><updated>2013-05-21T10:25:32.291-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2013-05-21T10:25:32.291-04:00</app:edited><title>Untouched by Morning, Poetry review</title><content type="html">Untouched by Morning is a second chapbook of poetry by Francis Klein. 
His first, Podebrady, is also available from Amazon, and I gave it high 
marks.&lt;br /&gt;&lt;br /&gt;The poems in this book have a consistent theme, looking at
 the lives of those who have completed life. The mind immediately leaps 
to a comparison with Spoon River Anthology, but these are on the whole 
more sophisticated thoughts on more thoughtful lives.&lt;br /&gt;&lt;br /&gt;I enjoyed 
these poems exactly because they were insightful, looking at the nexus 
of life and accomplishment. We are treated, not to superficial 
reflection, but to the deeper flash of diamond, entering and 
illuminating.&lt;br /&gt;&lt;br /&gt;Recommended.
      &lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/M95zma5n9Sk" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/4104041943976184899/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=4104041943976184899" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4104041943976184899?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4104041943976184899?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/M95zma5n9Sk/untouched-by-morning-poetry-review.html" title="Untouched by Morning, Poetry review" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2013/05/untouched-by-morning-poetry-review.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DEcDSHkyeyp7ImA9WhBXFU0.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-4470847223773259110</id><published>2013-03-28T17:27:00.001-04:00</published><updated>2013-03-28T17:27:59.793-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2013-03-28T17:27:59.793-04:00</app:edited><title>Gentleman detectives, some recent reading in mystery fiction</title><content type="html">&lt;div dir='ltr'&gt;  &lt;style&gt;&lt;!-- .hmmessage P { margin:0px; padding:0px } body.hmmessage { font-size: 12pt; font-family:Calibri } --&gt;&lt;/style&gt; &lt;div dir="ltr"&gt;I've recently ploughed through several mystery novels by some of the best known writers, Golden Age and modern, examining the evolution of the gentleman detective.&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;I started by reading two of Georgette Heyer's books, featuring her detectives Inspectors Hemingway and Hannasyde. I started with Heyer because I enjoyed her mystery The Unfinished Clue, which I reviewed previously on my blog.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;Death in the Stocks and No Wind of Blame were both enjoyable, but did not rise above casual consumption reading. Heyer writes characters very well, but the plots are tiresome. As in The Unfinished Clue, there is a stock cast, including a solid, no-nonsense young woman who finds most of the clues and, unexpectedly, love. Both of these novels contain a good bit of farce, which detracts from the solving as it grows into a bigger part of the novel. The plots are pedestrian and the actual murders poorly worked out. It is said that Heyer's husband worked on the plots for her. He was an engineer turned barrister, and engineers and barristers are the male leads.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;The detectives, Hemingway and Hannasyde, only appear in the last third of the novels. They are poorly developed and forgettable personalities.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;Looking for more substantial fare, I read the first two of Dorothy L. Sayers' novels starring Lord Peter Wimsey. These are a blast, and I thought the first one was really excellent.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;Sayers cuts to the chase in modern fashion in the first book, Whose Body? The detective is on the scene almost from the first page. He is a strong, witty, and well drawn character. The second son of a duke, Wimsey is young, rich, and fascinated with old books and detection. His valet, Bunter, is a wonderful foil. Written in the middle 20's, the effects of the World War are still vividly present in this novel.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;The second Wimsey, Clouds of Witnesses, is less successful. The plot revolves on too many coincidences. Wimsey is shot in the shoulder and suffers a broken collarbone, which goes unspoken for the rest of the novel. Still, fun to read. I look forward to following the path of Wimsey.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;Having tried Wimsey, I went on to sample Ngaio Marsh's Roderick Alleyn. While Alleyn is also the second son of a noble (an earl, now), he is a Scotland Yard working stiff (Detective Inspector) as well. In his first outing, he solves a standard English country home weekend party murder. He also meets his regular foil, Nigel Bathgate, a young journalist. I found Alleyn less engaging than Wimsey, but will give him a second chance.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;Jumping forward, the modern author Elizabeth George has also created a noble detective. He is Thomas Lynley, the Eighth Earl of Asherton. No second son, he is the Earl himself. I think there is a certain title inflation going on here. Lynley is also a Scotland yard DI, paired in most of the books with Detective&amp;nbsp;Sargent&amp;nbsp;Barbara Havers. Havers is of lower class origins, and her awareness of class differences with Lynley crops up regularly.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;George's books are both mysteries and soap operas. Through the first four, there is as much emphasis on the personal life of the detective and his friends as there is on the case. This is just a tad wearisome, but I admit I am a sucker for this kind of thing. Each Lynley book has one main and several side murders. Written in the '80's, it is funny to watch the author grapple with rapidly changing technology. Computers are often referred to as 'word processors', as if this were a distinct appliance, for example.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;The fourth Lynley book attempts to fill in some of his backstory, at the cost of some tortuous continuity issues. Too much of the book is taken up by the soap opera aspect of the storytelling.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;As much as I am enjoying George, Lord Peter Wimsey is by far my favorite character. While he is decidedly eccentric, he is also the most human of these detectives, and the best drawn. I suppose this is saying that Sayers is the best author, as well.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;The classic SF detectives are Elijah Bailey and R Daneel Olivaaw. I think the stories by Isaac Asimov featuring this pair, a New York detective and his robot sidekick, are my baseline for all other detectives, even Holmes and Watson. This is just my personal history at work, since I read Asimov earlier than any other detective fiction.&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;/div&gt;  		 	   		  &lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/dAO0CFQZSzA" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/4470847223773259110/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=4470847223773259110" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4470847223773259110?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4470847223773259110?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/dAO0CFQZSzA/gentleman-detectives-some-recent.html" title="Gentleman detectives, some recent reading in mystery fiction" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2013/03/gentleman-detectives-some-recent.html</feedburner:origLink></entry><entry gd:etag="W/&quot;Ck4GR3g-eSp7ImA9WhNSGEU.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-4534841631428025007</id><published>2012-11-02T14:28:00.000-04:00</published><updated>2012-11-02T14:28:46.651-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T14:28:46.651-04:00</app:edited><title>WAMP Step 3: Install MySQL</title><content type="html">In the previous installments of this series (here and here), we set up and configured the Apache web server and the PHP scripting engine. Now we will add the database server, MySQL.&lt;br /&gt;
&lt;br /&gt;
SQL databases implement the powerful relational database paradigm, a way of thinking about data that is based in the mathematics of set theory. This makes them (in theory) more powerful and safer than other kinds of databases that preceded them. While relational databases started life on mainframes, MySQL is an example of how the concept can be adapted to desktops. After all, your desktop is probably a more powerful computer than the 'big iron' mainframe of the 1960's!&lt;br /&gt;
&lt;br /&gt;
&lt;h3&gt;
Installing MySQL&lt;/h3&gt;
&lt;br /&gt;
MySQL started as the project of an independent company, which was subsequently acquired by Oracle. A free and open version is still available, called the "community" server.&lt;br /&gt;
&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;The MySQL download for the Community Server is at&amp;nbsp;&lt;a href="http://www.mysql.com/downloads/mysql/"&gt;http://www.mysql.com/downloads/mysql/&lt;/a&gt;. If you just got&amp;nbsp;&lt;a href="http://www.mysql.com/downloads/mysql/"&gt;http://www.mysql.com/downloads/&lt;/a&gt;, you'll be offered a Windows installer that includes a whole bunch of additional software and connectors, over 200 MB of stuff! We don't need all of that to test out WordPress, which is the objective of this exercise. Just grab the installer for the Community Server.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;/span&gt;&lt;br /&gt;
&lt;a name='more'&gt;&lt;/a&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;
&lt;span style="font-family: inherit;"&gt;Click on the .msi file once it is downloaded and begin the install.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;Click "Run".&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;Click "Next"&lt;/span&gt;&lt;br /&gt;
&lt;span style="line-height: 20px;"&gt;&lt;span style="font-family: inherit;"&gt;Select “Typical”. Click “Next”.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;Click “Install”.&lt;/span&gt;&amp;nbsp;&lt;span style="line-height: 20px;"&gt;Click “Next”.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;Click “Next”.&lt;/span&gt;&lt;span style="line-height: 20px;"&gt;Select “Configure the MySQL Server now”. Click “Finish”.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;
&lt;br /&gt;
&lt;span style="line-height: 20px;"&gt;The installation will segue directly into the MySQL configuration process.&lt;/span&gt;&lt;br /&gt;
&lt;div&gt;
&lt;span style="line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;A Configuration Wizard will appear. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Detailed Configuration”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Developer Machine”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Multifunctional Database”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “C:” drive and “Installation Path”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Decision Support (DSS)/OLAP”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Enable TCP/IP Networking”. Set Port Number to: 3306. Select “Enable Strict Mode”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Standard Character Set”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Select “Install As Windows Service”. Select “Launch the MySQL Server automatically”.&amp;nbsp; Select “Include Bin Directory in Windows PATH”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Enter the new root password (twice): “example”. Click “Next”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Click “Execute”.&lt;/span&gt;&lt;br /&gt;&lt;span style="line-height: 20px;"&gt;Click “Finish”.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;br /&gt;
&lt;span style="line-height: 20px;"&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;
&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/Xv9eBvMd9LA" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/4534841631428025007/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=4534841631428025007" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4534841631428025007?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4534841631428025007?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/Xv9eBvMd9LA/wamp-step-3-install-mysql.html" title="WAMP Step 3: Install MySQL" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/wamp-step-3-install-mysql.html</feedburner:origLink></entry><entry gd:etag="W/&quot;C0MFR384cCp7ImA9WhNSGUQ.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-503723986885830013</id><published>2012-11-02T10:11:00.000-04:00</published><updated>2012-11-03T21:10:16.138-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-03T21:10:16.138-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="global warming" /><category scheme="http://www.blogger.com/atom/ns#" term="Hurricane Sandy" /><title>Global Warming: a brief background</title><content type="html">&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;I'm writing this for an audience that isn't short on science or Google chops. I'll try to supply links where useful.&lt;/span&gt;&lt;br /&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;We're here to discuss global warming, and several levels of skepticism expressed about global warming.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;ul&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;What is global warming (GW), and does it really exist?&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Is global warming anthropogenic (AGW)? That is to say - are human activities principally responsible for global warming?&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Is global warming catastrophic (CAGW)? Are the changes severe, irreversible and creating misery for humans and other life on the planet?&lt;/span&gt;&lt;/li&gt;
&lt;/ul&gt;
&lt;/div&gt;
&lt;div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;A basic issue of terminology - the problem we'll be discussing is one of heat, and heat is measured by temperature. However, there is not a one-to-one correspondence between the two ideas.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;/span&gt;&lt;br /&gt;
&lt;a name='more'&gt;&lt;/a&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;
It's a gas!&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Lets start with the basic physics of the gases that make up Earth's atmosphere. &lt;a href="http://en.wikipedia.org/wiki/Atmosphere_of_Earth" target="_blank"&gt;Our atmosphere&lt;/a&gt; is mainly composed of nitrogen, oxygen, water, argon, and carbon dioxide in order of abundance. We can see through the atmosphere quite well, in other words, it is transparent to photons. If the photons streaming down at us from the Sun were caught by the molecules and atoms of the atmosphere, we would not be able to see through it.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;(Of course, the atmosphere is not perfectly transparent, which is why we see light from the whole sky, not just directly from the sun.)&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The Sun supplies the vast majority of heat to the surface of the planet. Heat due to radioactivity in the interior is a negligible source, as is the heat from chemical burning such as forest fires and anthropogenic sources. It would be a really dumb skeptical argument to say "heat from burning in power plants and car engines is too little to cause global warming, therefore GW&amp;nbsp;isn't&amp;nbsp;real." That argument misses the big idea, that human burning activities release carbon dioxide (principally) into the air.&lt;/span&gt;&lt;/div&gt;
&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Light travels into the Earth's atmosphere and through it. The light strikes land or water and is absorbed. These are high energy photons of visible light. The water and land release this absorbed energy as longer wavelength infrared radiation.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;If the atmosphere was as transparent to infrared as it was to visible light, this would just travel back up through the atmosphere and out to space. However, it is not.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Some molecules trap the infrared as it is radiated by the land and sea. Which molecules? We've known since the 19th century that molecules with combinations of&amp;nbsp;different&amp;nbsp;atoms will absorb infrared energy. Molecules that are made of pairs of the same atoms (such as N2, O2, and H2) do not absorb infrared. Gases that are single atoms, such as argon, xenon, and neon, also don't absorb infrared.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Water (H2O), carbon dioxide (CO2), methane (CH4), and other more complicated molecules do absorb infrared. In general, the more different the atoms in the molecule are, the more there are electrically positive and negative 'ends' to the molecule, the more angles are involved, the more that molecule can absorb infrared.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;These differences in properties explain why water is a more potent absorber of IR that CO2. H2O has a bond angle that makes it look like a boomerang, with pronounced negative and positive charge distribution. CO2, on the other hand, has a bond angle of 180 degrees - all the atoms are on one line. As a result, CO2 has fewer ways to absorb IR radiation than H2O.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;All of these molecules that absorb IR have been called &lt;a href="http://en.wikipedia.org/wiki/Greenhouse_gas" target="_blank"&gt;greenhouse gases&lt;/a&gt; (GHGs) because they help warm the planet. If there were no water or CO2 in the atmosphere, we could have 10 times as much nitrogen or oxygen, it wouldn't make the planet warmer. If the planet had a much thinner atmosphere, without the nitrogen or oxygen, it would still have a similar surface temperature as it does now.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Some skeptical arguments start with the idea that CO2 is a 'trace gas', and therefore must be a small contributor to the overall heating process. This is simply false, based on the science of how molecules absorb IR. The small contributors are nitrogen and oxygen, even though they make up the majority of the atmosphere.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;As an aside, some folks with an interest in Mars colonization have suggested that the Martian atmosphere be pumped up with relatively small amounts of very powerful greenhouse gases. Only enough would be necessary to raise the temperature at the poles to cause the CO2 ice there to sublimate into the atmosphere and contribute its own warming power. The resulting Martian atmosphere would still be thin and unbreathable, but warm.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Stepping back from Terraforming Mars, we must consider how we are Terraforming Terra - that is, changing our planet by changing the balance of GHGs in the atmosphere.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Even the scientists who first studied the IR&amp;nbsp;absorption&amp;nbsp;of gases speculated that mankind's contribution of CO2 to the atmosphere could warm the planet. One such was &lt;a href="http://en.wikipedia.org/wiki/Svante_Arrhenius" target="_blank"&gt;Svante Arrhenius&lt;/a&gt;. I say Arrenhius was speculating because while he knew the underlying mechanism, he had no way of measuring the effects. As it happened, he also thought that the overall balance of warming the Earth would be beneficial. This idea still recurs in skeptical thinking - "I don't believe AGW is real, but if it was real, it would be a good thing."&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;But is it Anthropogenic?&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Starting in the 1950s, careful measurements have been made of the gas composition of the atmosphere. In general, the atmosphere of the Earth is well mixed. There are places such as the poles where that isn't true in very specific ways, such as the ozone hole over the South Pole. The measurements are made at an&lt;a href="http://en.wikipedia.org/wiki/Keeling_Curve" target="_blank"&gt; atmospheric lab at the top of Mauna Loa, Hawaii&lt;/a&gt; so that there are no nearby factories or cities to make interpreting the results difficult.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;This series of measurements shows a steady rise in CO2 throughout the last half of the 20th century. In fact, CO2 has risen 38% since 1750, most of that in the last 50 years. (&lt;a href="http://www.epa.gov/climatechange/science/indicators/ghg/ghg-concentrations.html" target="_blank"&gt;EPA source&lt;/a&gt;) All very well, a skeptic might say, but is the source of this CO2 anthropogenic? Yes.&amp;nbsp;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
CO2 from anthropogenic burning of fossil fuels is releasing into the atmosphere carbon that has been sequestered under the earth for millions of years. This carbon was originally plant material, and plants prefer to use carbon-12 (instead of the heavier C-13 or the radioactive C-14). The atmosphere had a particular signature of isotopes C-12 to C-13 ratio, and that ratio has been changing as CO2 has entered the atmosphere. This new CO2 also has little C-14, because almost all of this has decayed away over time in fossil fuels.&amp;nbsp;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;This is the signature of old, fossil carbon entering the atmosphere, and that is the key to attributing the rising CO2 to mankind. The case is even clearer with all of the other GHGs, some of which are unnatural and only come from industrial sources. In addition, there are no obvious natural sources that can account for the trend - no steady rise in the number of volcanic eruptions, for example.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
&lt;/span&gt;&lt;br /&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Why focus on CO2?&lt;/span&gt;&lt;/h3&gt;
&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;At this point, I'll say that CO2 is the most talked about GHG, even though it is not the most potent or the most plentiful. Water is the most plentiful GHG and is more powerful than CO2. Other, more exotic gases are much&amp;nbsp;&lt;/span&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;more powerful.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;So why focus on CO2? The best reason is what is known as residence time. CO2 stays in the atmosphere a long time. On average, a CO2 molecule will float around for thousands of years before being broken down into something else or used by a plant. In comparison, water molecules only stay in the atmosphere for an average of 11 days! Methane is more powerful, but has a residence time of 15 years. (Methane's short residence time is the reason that most concern over the release of methane from the thawing permafrost or from under the Arctic Ocean is overblown.)&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;So CO2 is not a very powerful GHG, but it is the 2nd most plentiful GHG after water and has a much longer residence time. That makes it important. Water is important to the background level of global warmth, but not to changes in that level. The overall humidity of the atmosphere is not changing with a clear, dangerous trend.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Heat vs. Temperature&lt;/span&gt;&lt;/h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Now that we've identified anthropogenic CO2 entering the atmosphere, our understanding of the physics of CO2 would lead us to expect an increase in heat trapped by this gas. This heat can go many places in the total system of the surface of the planet, and only some of those places will change the temperature of the planet.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;An easy example is the melting of the Arctic ice cap. The temperature of a mixture of ice and water will stay at 32F, even while that mixture is absorbing a tremendous amount of heat. The heat is being used to melt the ice. In general the heat capacity of the world's oceans is very large, and water can absorb much more heat than the air above it for a given change in temperature.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;This brings us to the difficult point of measuring global changes in absorbed heat&amp;nbsp;by global changes in temperature. Global warming is a problem of more heat, but the temperature of land, air, or sea can poorly reflect that. Indeed, the temperature of the land, sea, and air can all vary from each other significantly.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Other Forcings&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;There are many drivers of global heat and therefore temperature, besides GHGs. The Sun itself varies in power, and the distance of the Earth, and wobbles in the Earth's orbit also have strong effects. These wobbles, collectively known today as &lt;a href="http://en.wikipedia.org/wiki/Milankovitch_cycles" target="_blank"&gt;Milankovitch cycles&lt;/a&gt;, are responsible for the current pattern of ice ages (in concert with the position of the continents due to plate tectonics). These are long term sources of variation. Shorter term sources include volcanoes, which produce dust and aerosols that cool the planet by reflecting more sunlight into space.&amp;nbsp;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Even jet contrails can have an effect. Contrails act like other clouds. Clouds during the day reflect light away and cool the planet. Clouds at night reflect IR back down and warm the planet.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;In the geek-speak of climatology, all of these different effects are called forcings and they are measured in the currency of Watts per square meter per year, in order to keep them comparable.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Absent the effect of AGW, the consensus is that the Earth's climate would gradually be getting colder, as we head into another Ice Age. We have been in an interglacial period for the last 10,000 years or so, but this is ending.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Given that background, we would expect that the temperature trend would be downward, with some natural volatility representing the interplay of all the different forcings. And it was indeed downward, until the onset of the Industrial Revolution. Since that time, global temperatures have trended upwards, again with some natural volatility.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Much is made in the skeptical debate about the temperature trend, whether it has reached a record for the last x-thousand years, how temperatures are measured, etc. This is all sadly misguided. The real issue is not temperature, but heat. If temperatures haven't changed in 15 years, but most of the volume of ice in the Arctic has melted over the same period, that is evidence of global warming.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;For this reason, skeptic arguments that begin 'it was warmer in the past...' are irrelevant. Whatever set of solar activity, orbital forcings, and random variation caused the Medieval Warm Period (MWP) is not active today, and if it were, things would be much worse. We've reached the temperature extremes we have without their help.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The Little Ice Age and MWP were extremes, and temperatures reverted to the trend afterward. The point of AGW is that we've changed the trend. The new trend in temperature is not an unexplainable random variation that will pass, allowing the world to cool. Is is explainable by and attributable to AGW. It is up, not down.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Catastrophic?&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;All of the different forcings interact with each other, making it difficult to tease apart the effects of a single change. The effect of rising CO2 is itself limited. What has alarmed climate scientists is the effect of the interactions. Remember our aside about Mars. The erstwhile Terraformers only have to supply enough GHG to warm the icecaps. After that, the effect of the CO2 ice re-entering the atmosphere warms the planet much more. This is an example of a positive feedback. More CO2 in the Martian atmosphere captures more heat and raises the temperature which melts more CO2 ice, resulting in more CO2 in the atmosphere.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;These same sorts of positive feedbacks can occur on Earth. As an example, warm water can hold less dissolved gas than cold water. If the oceans warm, they will give up gases to the atmosphere, including CO2. The added CO2 will warm the oceans even further. It doesn't matter which came first, once the loop starts working in a certain direction, it is self reinforcing. You need an external event, such as a volcano erupting or an orbital wobble, to stop the cycle and send it in the opposite direction. And yes, it works just as easily in the opposite direction. Colder water absorbs more gas, pulling it out of the atmosphere, leaving less to warm the planet.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Unlike measuring the IR absorption spectra of a gas, accounting for all the forcings and interactions is difficult. Climate models have been built that try to account for them all, but there are extreme difficulties modeling an entire planet in enough detail to get a clear view of what is important.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;This question of what is the multiplier effect of the CO2 is the place where the science is the least settled.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;So what?&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;In an argument about global warming, skeptics often go through stages of acceptance, similar to the 5 stages of grief. From an opening position denying GW is happening at all, they will be forced by the preponderance of evidence to agree that yes, GW is happening, and yes, it is anthropogenic. Perhaps the multiplier really is strong. But so what? Isn't GW really a good thing?&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Basically, no. Our economic and ecological systems are tuned to a certain set of parameters. The growing season is this long at this latitude. Rain falls here in such and such an amount. The tides are this high.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Changes in climate eventually manifest as changes in weather. For the Northern Hemisphere, one serious way that will happen relates to the jet stream.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The jet stream is a band of fast moving air circling the North Pole. It marks the boundary between cold polar air and more temperate air. The recent melting of the Arctic ice has weakened the jet stream (By weakening the contrast between polar and mid-latitude air temperatures), leading to it becoming unstable. In terms of weather, this has led to the phenomenon of "blocking highs". Weather systems develop and then stay put, baking or freezing a region instead of moving on. A pattern called 'Warm Arctic, Cold Continents' (WACC) develops in the winter. Snowmageddon, Snowpocalypse, the killer cold in Europe in 2011 are all examples.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Anyone who has seen a century of growing season maps knows that the effect of AGW is real. It has a cost, in forcing farmers to plant new crops, learn new methods. It has a cost in contributing to extinction of species by reducing and relocating habitats. AGW is producing changes in decades that used to take thousands of years.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Besides changes in weather patterns, sea level rise is usually listed as a large danger stemming from AGW. If significant amounts of land based ice were to melt, there could be a rise in sea levels. The sources of this would have to be the Greenland ice sheet in the Northern Hemisphere, and the Antarctic continental ice sheet in the south. Mountain glaciers, while disappearing quickly, are not an appreciable source of water compared to these large ice sheets.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Ice sheet melting and sea level rise will happen much more slowly than other, weather related changes. However, they are also irreversible within the span of human technologies now available. A rise in sea level of one foot on average by the end of the century seems possible. It doesn't sound like much, but could affect millions of people who live in low lying areas such as Bangladesh (or Florida). The use of an average number obscures the effect on storms and storm surges. We have built the infrastructure of our cities for a certain sea level, and rebuilding for a different sea level will cost a lot of money. The storm surge of Hurricane Sandy brings this lesson home.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;AGW is just the latest in a series of challenges to the rule of law, and the extension of legal principles across national borders to address "tragedy of the commons" issues. The tragedy of the commons refers to the situation in an English village where the 'commons' was grassland owned by everyone and no-one. As a result, everyone felt free to graze their sheep there. Overuse leads to destruction and the resource becomes useless to everyone.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Acid rain and the ozone hole are previous examples of nations working within the legal system to handle injuries to the commons of the atmosphere.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
&lt;/span&gt;&lt;br /&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Skepticism&lt;/span&gt;&lt;/h3&gt;
&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Instead of addressing the range of policy responses to AGW, many skeptics would prefer to argue that the problem does not exist, has a source other than man, cannot be stopped, or is a good thing anyway. We have shown above that the problem does exist, and its source is man-made. Therefore it is up to us to try to ameliorate the effects of our own actions.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Reading the comments at a popular skeptical website such as WattsUpWithThat, it is clear to me that there are several common themes among skeptics. They distrust national governments and distrust the idea of cross-national coordination. They fear 'one world government', and see a conspiracy to impose the UN as a world government (just a front for Russian communists, of course) through the ruse of GW scare-mongering. They deeply resent any possible restriction on personal privilege, or additional cost associated with specific behaviors.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The result is that skeptics misuse their energies arguing against the facts instead of creating useful alternatives to possible policies they dislike. If you don't like a blanket carbon tax, push for tax credits for hybrid vehicles. Replacing a gas guzzler with a hybrid is the easiest and most effective thing an individual in the developed world (specifically America) can do to reduce their carbon footprint - their personal contribution to AGW. Raise taxes on beef products to recognize the high cost of raising cattle. In other words, make fighting GW a personal choice, in line with the philosophy of personal choice and taking personal responsibility for our actions.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Unfortunately, skeptics prefer to demonize certain high profile scientists such as Michael Mann, Phil Jones, James Hansen, and Kevin Trenberth. The skeptical community has bought into the same doubt-casting that the tobacco industry used to fight the scientific evidence that smoking causes cancer. Big Oil has turned to the same set of spin doctors as Big Tobacco used, such as &lt;a href="http://en.wikipedia.org/wiki/Heartland_Institute" target="_blank"&gt;The Heartland Institute&lt;/a&gt;, and reuses much of the &lt;a href="http://en.wikipedia.org/wiki/Merchants_of_Doubt" target="_blank"&gt;same playbook&lt;/a&gt;, such as &lt;a href="http://en.wikipedia.org/wiki/The_Advancement_of_Sound_Science_Coalition" target="_blank"&gt;setting up fake 'grassroots' concern organizations&lt;/a&gt;.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;
&lt;br /&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Hurricane Sandy&lt;/span&gt;&lt;/h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;As a very topical point, many people have speculated about the connection between Hurricane Sandy and global warming.&amp;nbsp;&lt;a href="http://www.the-scientist.com/?articles.view/articleNo/33084/title/Opinion--Super-Storm-Sandy/" target="_blank"&gt;Kevin Trenberth's opinion piece&lt;/a&gt; in &lt;i&gt;The Scientist&lt;/i&gt; lays out the facts as they relate to Sandy in particular. Minnesota Public Radio's web site has also carried two recent pieces on &lt;a href="http://minnesota.publicradio.org/collections/special/columns/updraft/archive/2012/11/did_record_arctic_sea_ice_loss.shtml" target="_blank"&gt;Sandy hitting New Jersey&lt;/a&gt;, &lt;a href="http://minnesota.publicradio.org/collections/special/columns/updraft/archive/2012/11/winter_outlook_2012-13_unprece.shtml" target="_blank"&gt;the coming winter weather&lt;/a&gt; and climate change - specifically the melting of Arctic sea ice.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
Hurricanes form over warm tropical waters in the Atlantic near Africa. They become self-sustaining, as long as they can draw energy from ocean waters above 25C in temperature.&amp;nbsp;If the ocean in the North Atlantic stays warmer than 25C even in high latitudes, hurricanes can sustain themselves farther north than 'normal.'As an example, when Sandy crossed over the Gulf Stream at the level of the Carolinas, the storm intensified as it pulled heat out of water that was 27C (80F!).&amp;nbsp;Obviously, if the oceans contain more heat, they can generate more tropical storms. This can manifest as storms earlier in the season, later in the season, or more powerful storms.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
Instead of focusing on a single storm such as Sandy, it is more appropriate in my opinion to look at an index of the total power of all the storms in a season. One such measure is the &lt;a href="http://en.wikipedia.org/wiki/Accumulated_cyclone_energy" target="_blank"&gt;accumulated cyclone energy&lt;/a&gt; of the entire Atlantic. While there is a &lt;a href="http://www.aoml.noaa.gov/hrd/tcfaq/E11.html" target="_blank"&gt;clear upward trend in the raw data&lt;/a&gt;, there are also confounding influences, such improved data gathering over time. However the overall implication is clear that tropical storms are increasing due to more available energy in the oceans.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
Hurricanes are engines for taking heat from the ocean, raising it to the top of the atmosphere, and allowing it to radiate away into space. As such, they are an alternative to a gradual rise in global temperature, just as melting ice is an alternative.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;
&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;h3&gt;
&lt;span style="font-family: Arial, Helvetica, sans-serif; font-size: small;"&gt;Summary&lt;/span&gt;&lt;/h3&gt;
&lt;div&gt;
&lt;ul&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Global warming is happening. The planet is holding more heat from the sun than it used to. This heat will eventually have visible effects, such as melting Arctic ice, powering more, and more powerful, storms, and changing weather patterns.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Global warming is an inevitable consequence of adding CO2, a powerful and long-lasting greenhouse gas, to the atmosphere.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Global warming is caused by our activities. Burning fossil fuels has several effects on the atmosphere, depending on what in specific is being burned. Soot and aerosols may briefly cause clouds that cool the planet, but CO2 and soot falling on ice warm the planet. The strongest and most consistent effect of the use of fossil fuels in the rise of CO2 in the atmosphere. (Tropical deforestation also releases CO2, and causes other negative effects that warm the planet.)&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Anthropogenic global warming has reversed the long term climactic trend towards cooler climate. This is happening faster than the global infrastructure can react without significant costs.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;&lt;a href="http://skepticalscience.com/nuccitelli-et-al-2012.html" target="_blank"&gt;Measures of heat in the environment continue to rise&lt;/a&gt;, even while temperature records show volatility.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;While much of the debate on AGW has focused on temperature records and proxies for temperature records, these records involve the mixed effects of multiple drivers. The one driver that correlates best with temperature change is CO2 rise. 'Cycles' and 'natural variation' are often cited by skeptics as the cause of the temperature record, but all such sources have already been included and found wanting as explanatory variables.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;If El Nino, cosmic rays, or the Sun were responsible for global warming we would still have a responsibility to ameliorate what we can. Even more so when the cause is our own lifestyle choices. This is a fixed principle of our moral and legal systems.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The forward looking modeling of climate change shows that the effect of CO2 rise will have a multiplier effect. What that multiplier is is not clear at this time, but skeptics aren't helping to clarify the issue by constructing better models - they are tearing down the idea of trying to solve the problem at all.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;Many of the effects of AGW will take longer than a single human lifetime to manifest themselves. This is no excuse for inaction. Amelioration becomes harder and more costly, the longer we wait. Paper companies plant forests. Insurance companies invest in bonds. We know how to make long term decisions with the hope that our children's lives will be better - that is what brought us all to America. AGW is no different than other environmental challenges that we have become aware of over time.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The miracle of compound interest is currently working against us, but that can be changed. Investing now in solutions will save enormous amounts in the future, not just of money but of human misery.&lt;/span&gt;&lt;/li&gt;
&lt;li&gt;&lt;span style="font-family: Arial, Helvetica, sans-serif;"&gt;The debate over global warming is a controversy manufactured by large corporations to protect themselves. These companies have co-opted the fears and political tendencies of individuals to protect themselves as corporate entities. Good hearted and open minded individuals of all political persuasions can, and should, participate in the policy debate based on a common set of facts. AGW is real, what we do about it is the question.&lt;/span&gt;&lt;/li&gt;
&lt;/ul&gt;
&lt;/div&gt;
&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/Qf4SPnAMCK4" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/503723986885830013/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=503723986885830013" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/503723986885830013?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/503723986885830013?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/Qf4SPnAMCK4/global-warming-brief-background.html" title="Global Warming: a brief background" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/11/global-warming-brief-background.html</feedburner:origLink></entry><entry gd:etag="W/&quot;A0QGQH4-cCp7ImA9WhNSGEs.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-5836832401820427746</id><published>2012-11-01T10:44:00.000-04:00</published><updated>2012-11-02T11:15:21.058-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T11:15:21.058-04:00</app:edited><title>Podebrady, Poetry by Francis Klein, reviewed by Davd vun Kannon</title><content type="html">&lt;i&gt;Podebrady&lt;/i&gt; is a slim chapbook of poetry. The poems inside are, at times, a painfully intimate window into the author's heart. But they are also full of wisdom, beautiful words and images, and the painful intimacy is mostly the result of recognizing ourselves waiting in the mirror of these words.&lt;br /&gt;
&lt;br /&gt;
I especially like the &lt;i&gt;The Apple Press,&lt;/i&gt; and the last lines of &lt;i&gt;Morning Laundry:&lt;/i&gt;&lt;br /&gt;
&lt;i&gt;&lt;br /&gt;&lt;/i&gt;
&lt;br /&gt;
&lt;blockquote class="tr_bq"&gt;
&lt;i&gt;We are replaced by what we love.&lt;/i&gt;&lt;/blockquote&gt;
&lt;blockquote class="tr_bq"&gt;
&lt;i&gt;We leave the green fields free and fallow.&amp;nbsp;&lt;/i&gt;&lt;/blockquote&gt;
&lt;br /&gt;
Klein is a published poet and an architect with a practice in Montclair, NJ. &lt;a href="http://www.amazon.com/Podebrady-Francis-Klein/dp/1599247348" target="_blank"&gt;&lt;i&gt;Podebrady&lt;/i&gt; is avaible from Amazon&lt;/a&gt; and Finishing Line Press.&lt;br /&gt;
&lt;br /&gt;
Recommended.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/NLHKiqoa72o" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/5836832401820427746/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=5836832401820427746" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5836832401820427746?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5836832401820427746?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/NLHKiqoa72o/podebrady-poetry-by-francis-klein.html" title="Podebrady, Poetry by Francis Klein, reviewed by Davd vun Kannon" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/11/podebrady-poetry-by-francis-klein.html</feedburner:origLink></entry><entry gd:etag="W/&quot;A0MESHs6cCp7ImA9WhNSGEs.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-6076105338268024854</id><published>2012-10-28T21:59:00.001-04:00</published><updated>2012-11-02T11:16:49.518-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T11:16:49.518-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="fun" /><category scheme="http://www.blogger.com/atom/ns#" term="music" /><title>Nice Work If You Can Get It - Review</title><content type="html">&lt;i&gt;Nice Work If You Can Get It&lt;/i&gt; is a frothy bit of Broadway magic. The show features songs by George Gershwin, and a plot loosely (very loosely) based on his 1926 musical, &lt;i&gt;Oh, Kay&lt;/i&gt;. Other material from the film &lt;i&gt;Delicious&lt;/i&gt;, including the immortal love song Blah, Blah, Blah.&lt;br /&gt;
&lt;br /&gt;
The show stars Matthew Broderick, Kellie O'hara and a great cast. I saw a matinee last Saturday with my wife, my son Daniel, and a friend of his. We all laughed and clapped up a storm.&lt;br /&gt;
&lt;br /&gt;
The thin plot involves Broderick as Jimmy Winter, a dissolute young rich boy who prefers chorus girls to nice girls. But he's marrying a nice girl to secure his inheritance. Until he meets a bootlegging dame, Billie Bendix. Hilarity ensues.&lt;br /&gt;
&lt;br /&gt;
Apres theater dinner at Barbetta was excellent.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/wwRHFuQRpoI" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/6076105338268024854/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=6076105338268024854" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6076105338268024854?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6076105338268024854?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/wwRHFuQRpoI/nice-work-if-you-can-get-it-review.html" title="Nice Work If You Can Get It - Review" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/nice-work-if-you-can-get-it-review.html</feedburner:origLink></entry><entry gd:etag="W/&quot;Ck4ASX0zfSp7ImA9WhNSGEU.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-5340899437118880774</id><published>2012-10-18T13:45:00.000-04:00</published><updated>2012-11-02T14:29:08.385-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T14:29:08.385-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="WAMP" /><category scheme="http://www.blogger.com/atom/ns#" term="PHP" /><category scheme="http://www.blogger.com/atom/ns#" term="fun" /><category scheme="http://www.blogger.com/atom/ns#" term="Apache" /><category scheme="http://www.blogger.com/atom/ns#" term="geek moments" /><category scheme="http://www.blogger.com/atom/ns#" term="WordPress" /><title>WAMP Step 2: Install PHP</title><content type="html">As detailed in our &lt;a href="http://dvunkannon.blogspot.com/2012/10/wamp-step-1-apache-httpd-server.html" target="_blank"&gt;previous post&lt;/a&gt;, we are building towards a WordPress installation on a desktop PC. In step 1, we successfully installed and tested the Apache web server.&lt;br /&gt;
&lt;br /&gt;
As mentioned last time, some documents that are served by the web server to your web browser are static documents - just files sitting on the hard drive. Other documents are actually queries into a database, where the data has been dressed up and presented as a web page. Still other documents are mostly static, but with some customization by a script running on the server.&lt;br /&gt;
&lt;br /&gt;
To support WordPress, we are going to need both a database and a script engine. A very popular scripting language for web pages is&lt;a href="http://en.wikipedia.org/wiki/PHP" target="_blank"&gt; PHP&lt;/a&gt;, and that is what WordPress requires. The rest of this post will walk through installing PHP.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;a name='more'&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;
&lt;h3&gt;
1 - Installing PHP&lt;/h3&gt;
Go to PHP’s main website: www.php.net, to learn more about PHP, or head straight to&amp;nbsp;&lt;a href="http://windows.php.net/download/"&gt;http://windows.php.net/download/&lt;/a&gt;&amp;nbsp;to get the latest Windows binary install. Please read the warning on the left side of the page! Since we got Apache from apache.org, the last safe version according to this warning is 5.2.17. Click on the Installer link for the thread safe choice.&lt;br /&gt;
Locate the downloaded installer .msi file and double click on it to launch the installation wizard.&lt;br /&gt;
A “Welcome to the PHP X.X.X Setup Wizard” screen will appear. &amp;nbsp;Click “Next”.&lt;br /&gt;
Accept the terms of use. Click “Next”.&lt;br /&gt;
The install path should look like:&lt;br /&gt;
C:\Program Files\PHP\&lt;br /&gt;
Click “Next”.&lt;br /&gt;
Select how PHP will be used. For our situation, it should be “Apache 2.2.x Module”. Click “Next”.&lt;br /&gt;
Set the location of the Apache Configuration directory. &amp;nbsp;It should be:&lt;br /&gt;
C:\Program Files (x86)\Apache Software Foundation\Apache2.2\conf\&lt;br /&gt;
&lt;br /&gt;
The next screen will ask you what items you want to install. &amp;nbsp;Expand the “Extensions” section and click the arrow next to “MySQL”. Select “Entire feature will be installed on local hard drive”. Other extensions that will be useful to our intended WordPress setup are GD2, Multi-Byte Strings, mcrypt, XSL, and zip. Select these as well. I also went for the manual because I am a geek.&amp;nbsp;Click “Next”.&lt;br /&gt;
Click “Install”.&lt;br /&gt;
Wait for installation to complete. Click “Finish”.&lt;br /&gt;
Keep the .msi file so that you can add new extensions from it later.&lt;br /&gt;
&lt;h3&gt;
2 - Configuring Apache to work with PHP&lt;/h3&gt;
Apache is configured through entries in several files. As I warned earlier, you must have Modify permission to edit and save the changes to these.&lt;br /&gt;
Go to:&lt;br /&gt;
C:\Program Files\Apache Software Foundation\Apache2.2\conf&lt;br /&gt;
Open “httpd.conf” in Notepad. This is Apache's main configuration file. You might want to save a copy of the original first. Notice that this file uses forward slashes (Unix style) instead of Windows-style backward slashes in directory names, and also doesn't put quotes around directory names that contain spaces.&lt;br /&gt;
&lt;br /&gt;
Replace the line:&lt;br /&gt;
DocumentRoot "C:/Program Files/Apache Software Foundation/Apache2.2/htdocs"&lt;br /&gt;
With:&lt;br /&gt;
DocumentRoot "C:/sites/example/content"&lt;br /&gt;
This change tells Apache where the web content can be found, since we are not using the default location.&lt;br /&gt;
&lt;br /&gt;
Replace the line:&lt;br /&gt;
&lt;directory files="files" foundation="foundation" htdocs="htdocs" pache2.2="pache2.2" pache="pache" rogram="rogram" software="software"&gt;&lt;/directory&gt;&lt;br /&gt;
With:&lt;br /&gt;
&lt;directory content="content" example="example" sites="sites"&gt;&lt;/directory&gt;&lt;br /&gt;
Ibid.&lt;br /&gt;
&lt;br /&gt;
Replace the line:&lt;br /&gt;
DirectoryIndex index.html&lt;br /&gt;
With:&lt;br /&gt;
DirectoryIndex index.html index.php&lt;br /&gt;
This change tells Apache what files to look for as the home page for a web site. In addition to looking for index.html, Apache will look for index.php if it did not find the first file name in the directory.&lt;br /&gt;
&lt;br /&gt;
The PHP installation process has added a few lines to the bottom of the configuration file:&lt;br /&gt;
&lt;br /&gt;
#BEGIN PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL&lt;br /&gt;
PHPIniDir ""&lt;br /&gt;
LoadModule php5_module "php5apache2_2.dll"&lt;br /&gt;
#END PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL&lt;br /&gt;
&lt;div&gt;
&lt;br /&gt;&lt;/div&gt;
&lt;br /&gt;
Add the following lines above the lines added by PHP:&lt;br /&gt;
AddType application/x-httpd-php .php&lt;br /&gt;
AddType application/x-httpd-php-source .phps&lt;br /&gt;
These lines tell Apache which files it should understand as PHP files - ones that contain ".php" in the file name. Not just at the end of the file name, like a Windows file extension, but anywhere in the file name. There are ways to change this to be more like our expectation.&lt;br /&gt;
&lt;br /&gt;
The PHP lines also need editing to include the directory information. Add the path "C:/Program Files (x86)/PHP/" to both lines so that they look like this:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
#BEGIN PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL&lt;br /&gt;
PHPIniDir "C:/Program Files (x86)/PHP/"&lt;br /&gt;
LoadModule php5_module "C:/Program Files (x86)/PHP/php5apache2_2.dll"&lt;br /&gt;
#END PHP INSTALLER EDITS - REMOVE ONLY ON UNINSTALL&lt;br /&gt;
&lt;div&gt;
&lt;br /&gt;&lt;/div&gt;
&lt;br /&gt;
&lt;br /&gt;
Search for the line:&lt;br /&gt;
# AllowOverride controls what directives may be placed in .htaccess files.&lt;br /&gt;
Replace this line (which should be below the line you just searched for):&lt;br /&gt;
AllowOverride None&lt;br /&gt;
With:&lt;br /&gt;
AllowOverride All&lt;br /&gt;
Click File -&amp;gt; Save.&lt;br /&gt;
Click File -&amp;gt; Exit.&lt;br /&gt;
&lt;br /&gt;
&lt;h3&gt;
3 - Configuring PHP&lt;/h3&gt;
This first part is entirely optional. Go to:&lt;br /&gt;
C:\Program Files (x86)\PHP&lt;br /&gt;
Make sure you have Modify permissions, and then open “php.ini” in Notepad.&lt;br /&gt;
Replace the line:&lt;br /&gt;
upload_max_filesize = 2M&lt;br /&gt;
With:&lt;br /&gt;
upload_max_filesize = 10M&lt;br /&gt;
Replace the line:&lt;br /&gt;
post_max_size = 8M&lt;br /&gt;
With:&lt;br /&gt;
post_max_size = 20M&lt;br /&gt;
Replace the line:&lt;br /&gt;
short_open_tag = Off&lt;br /&gt;
With:&lt;br /&gt;
short_open_tag = On&lt;br /&gt;
Replace the XXX on the line with your ISP’s SMTP server, YYY:&lt;br /&gt;
SMTP = XXX&lt;br /&gt;
With:&lt;br /&gt;
SMTP = YYY&lt;br /&gt;
Example:&lt;br /&gt;
SMTP = mail.earthlink.net&lt;br /&gt;
Save the file. Done with the optional part.&lt;br /&gt;
&lt;br /&gt;
Now we are going to create our first scripted web page!&amp;nbsp;Go to:&lt;br /&gt;
C:\sites\example\content&lt;br /&gt;
Create a file called “phpinfo.php” and open it with Notepad.&lt;br /&gt;
Enter in:&lt;br /&gt;
phpinfo();&lt;br /&gt;
?&amp;gt;&lt;br /&gt;
Save and close the file.&lt;br /&gt;
Restart Apache. As I said in the previous post, you can do this in several ways - through the Services tool, the Apache Monitor available in the System Tray, or with the command prompt. Here is yet another way:&lt;br /&gt;
Click Start-&amp;gt;Programs-&amp;gt;Apache HTTP Server X.X-&amp;gt;Control Apache Server-&amp;gt;Restart.&lt;br /&gt;
Now to test that Apache and PHP are correctly configured, go to:&lt;br /&gt;
http://localhost/phpinfo.php&lt;br /&gt;
You should see a web page with detailed information about your PHP configuration.&lt;br /&gt;
&lt;br /&gt;
&lt;h3&gt;
4 - Problems?&lt;/h3&gt;
The main problems I encountered at this stage was the connection between Apache and PHP not working. This is why I changed the PHP lines at the bottom of the httpd.conf file - to make sure Apache knew where to find the PHP module.&lt;br /&gt;
&lt;br /&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/wxXTdMX3e9U" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/5340899437118880774/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=5340899437118880774" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5340899437118880774?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5340899437118880774?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/wxXTdMX3e9U/wamp-step-2-install-php.html" title="WAMP Step 2: Install PHP" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/wamp-step-2-install-php.html</feedburner:origLink></entry><entry gd:etag="W/&quot;Ck4CR3g8fSp7ImA9WhNSGEU.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-8114024718777863519</id><published>2012-10-17T16:22:00.000-04:00</published><updated>2012-11-02T14:29:26.675-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T14:29:26.675-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="WAMP" /><category scheme="http://www.blogger.com/atom/ns#" term="Apache" /><category scheme="http://www.blogger.com/atom/ns#" term="geek moments" /><category scheme="http://www.blogger.com/atom/ns#" term="beginnings" /><title>WAMP step 1: the Apache httpd server</title><content type="html">Our goal in this process is to set up WordPress to serve the test content of a website and blog. Therefore the very first thing we are going to need is a web server.&lt;br /&gt;
&lt;br /&gt;
I should say at the beginning that you don't need a web server to test basic web pages, you can write HTML files with any text editor, and then point your web browser at the file. You can teach yourself a lot of HTML and client-side JavaScript programming in this way. I think it is better to learn the fundamentals of how web pages work by typing it out for yourself instead of starting with a web development environment - you really understand what is going on.&lt;br /&gt;
&lt;br /&gt;
Web servers deliver content to browsers. This content (web pages, music, images, etc.) is either a file on your machine's hard drive, or data stored in a database (on the hard drive). If it is data from the database, then a program (a script) must be run first to turn it into a document that is served out by the web server.&lt;br /&gt;
&lt;br /&gt;
So even before we set up our Apache web server, we need to set up some space on our hard drive where this content will live. Importantly, we want this space to be independent of the Apache server file structure, so that we can back it up separately, and update Apache if necessary without moving our content. We could even change web servers entirely and our content would still be in the same place.&lt;br /&gt;
&lt;br /&gt;
&lt;a name='more'&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;
&lt;h3&gt;
1 - Create your content file directories&lt;/h3&gt;
Use Windows Explorer to create a 'sites' directory on C:. You can vary the name and the drive letter, just be consistent as you follow all of the instructions.&lt;br /&gt;
Within C:\sites, create a directory for your first website, 'example'.&lt;br /&gt;
Within C:\sites\example, create a directory for the content of this site, 'content'.&lt;br /&gt;
&lt;br /&gt;
&lt;h3&gt;
2 - Install Apache&lt;/h3&gt;
Go to the web site&amp;nbsp;&lt;a href="http://httpd.apache.org/" target="_blank"&gt;httpd.apache.org&lt;/a&gt;&amp;nbsp;to learn more about the Apache web server. The actual Windows binary files you'll need to install Apache are located at&amp;nbsp;&lt;a href="http://mirror.sdunix.com/apache//httpd/binaries/win32/"&gt;http://mirror.sdunix.com/apache//httpd/binaries/win32/&lt;/a&gt;&amp;nbsp;and you should download the MSI (Microsoft Installer) file, such as&amp;nbsp;&lt;a href="http://mirror.sdunix.com/apache//httpd/binaries/win32/httpd-2.2.22-win32-x86-openssl-0.9.8t.msi"&gt;httpd-2.2.22-win32-x86-openssl-0.9.8t.msi&lt;/a&gt;.&lt;br /&gt;
Double clicking on the .msi file after it is downloaded will start the installation process.&lt;br /&gt;
Choose "Run". A welcome screen is displayed.&amp;nbsp;Click "Next".&lt;br /&gt;
&lt;br /&gt;
A “Welcome to the Installation Wizard” will appear. &amp;nbsp;Click “Next”.&lt;br /&gt;
Accept the terms of use. Click “Next”.&lt;br /&gt;
A notice will appear. Click “Next”.&lt;br /&gt;
&lt;br /&gt;
We will be using the Apache server to serve documents off of the same machine as the browser. In the geek speak of the web, this self reference is called the "localhost". You'll use this term in the next part of the install.&lt;br /&gt;
&lt;br /&gt;
You will be prompted to enter your server’s information. &amp;nbsp;Use the following:&lt;br /&gt;
Network Domain: localhost&lt;br /&gt;
Server Name: localhost&lt;br /&gt;
Administrator’s Email Address: admin@example.com&lt;br /&gt;
&lt;br /&gt;
Select “for All Users, on Port 80, as a Service – Recommended”.&lt;br /&gt;
Click “Next”.&lt;br /&gt;
&lt;br /&gt;
For all Users is self explanatory.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
As a service means that the software will run without any windows open on your desktop, and will be started automatically each time you reboot your machine. You interact with services using the Microsoft Management Console (Control Panel/System and Security/Administrative Tools/Services).&lt;br /&gt;
&lt;div&gt;
&lt;br /&gt;&lt;/div&gt;
&lt;br /&gt;
Port 80 is the internet standard for http protocol traffic. Historically, as different kinds of computer communication were developed, each claimed a specific port for itself. Another example is the area of online games, where each uses specific, agreed upon ports to communicate. The web is so ubiquitous at this point that firewalls will always leave port 80 open, even as they disallow traffic on most ports to help keep your PC secure.&lt;br /&gt;
&lt;br /&gt;
A side effect of this is that some applications, such as Skype, will try to use port 80 for themselves. Skype figures that a desktop PC used for Skype is unlikely to run a web server, so it grabs 80 for itself. This means that in the situation we are in right now, Skype is probably going to cause some problems. As a way to head off these problems, open Skype and go to Tools/Options/Advanced/Connection and uncheck the box that is labelled "Use port 80 and 443 as alternatives for incoming connections". Save, quit Skype and restart it.&lt;br /&gt;
&lt;br /&gt;
Select “Typical” setup type. Click “Next”.&lt;br /&gt;
The install path should look like:&lt;br /&gt;
C:\Program Files\Apache Software Foundation\ApacheX.X\&lt;br /&gt;
Click “Next”.&lt;br /&gt;
Click “Install”.&lt;br /&gt;
Wait for installation to complete. Click “Finish”.&lt;br /&gt;
Type http://localhost in the address bar of your browser and make sure it displays “It works!”. "It works!" is the content of a very simple HTML file that Apache installed on your hard drive as part of the installation process. Seeing this displayed is proof that Apache is working correctly.&lt;br /&gt;
&lt;br /&gt;
&lt;h2&gt;
Problems?&lt;/h2&gt;
&lt;br /&gt;
Of course, it might not be working correctly. We tried to head off the most common reason (for desktop PCs, anyway) by changing Skype's settings. Another possibility is that you are running an anti-virus program that won't let Apache use port 80, or that another program is already using port 80 (not Skype). Try checking your anti-virus program documentation for how to allow a web server to run, and to see if any other program is using port 80, follow &lt;a href="http://www.thesitewizard.com/apache/install-apache-on-vista.shtml" target="_blank"&gt;some good directions on using netstat&lt;/a&gt; for this purpose.&lt;br /&gt;
&lt;br /&gt;
Installing Apache means you also got a tool that lives in the system tray, the Apache Monitor. You can use this tool instead of the Services console I mentioned earlier to stop, start, and restart Apache. However, both of these UI tools will not give you the best error messages when something is going wrong with Apache. For that, you will have to use the command prompt.&lt;br /&gt;
&lt;br /&gt;
To use the command prompt, open it with Startup/All Programs/Accessories/Command Prompt. I first change directories:&lt;br /&gt;
cd C:\"Program Files (x86)"\"Apache Software Foundation"\Apache2.2\bin&lt;br /&gt;
&lt;br /&gt;
Assuming you've got the quotes and spelling correct, you are now in the directory where the web server executable file is kept. At the prompt, type&lt;br /&gt;
&lt;br /&gt;
httpd.exe&lt;br /&gt;
&lt;br /&gt;
This is the file name of the Apache web server. If it starts correctly, you won't get another prompt (because the program is running). If there is a problem, you'll get a much more informative error message and a new prompt.&lt;br /&gt;
&lt;br /&gt;
In subsequent steps of installing the WAMP stack, it will be necessary to edit some of Apache's configuration files. Since these are in the "Program Files (x86)" file structure, Windows has automatically made them write protected. Before editing them the first time, use Explorer to open their properties, go to the Security tab, click Edit, choose Users in the top list, and check Modify in the lower pane. Click OK twice to close the windows. Now you can edit and save this file. Keep track of which files you've expanded the permissions on, so that you can go back at the end and restrict them again. As an alternative, log in to your machine as Administrator for this whole long process.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;div&gt;
&lt;br /&gt;&lt;/div&gt;
&lt;br /&gt;
&lt;br /&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/ESKorc4RQis" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/8114024718777863519/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=8114024718777863519" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/8114024718777863519?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/8114024718777863519?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/ESKorc4RQis/wamp-step-1-apache-httpd-server.html" title="WAMP step 1: the Apache httpd server" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/wamp-step-1-apache-httpd-server.html</feedburner:origLink></entry><entry gd:etag="W/&quot;C0YFSXc9fyp7ImA9WhNSGEU.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-3973023170391667860</id><published>2012-10-17T12:58:00.000-04:00</published><updated>2012-11-02T14:31:58.967-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-11-02T14:31:58.967-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="WAMP" /><category scheme="http://www.blogger.com/atom/ns#" term="MySQL" /><category scheme="http://www.blogger.com/atom/ns#" term="PHP" /><category scheme="http://www.blogger.com/atom/ns#" term="fun" /><category scheme="http://www.blogger.com/atom/ns#" term="Apache" /><category scheme="http://www.blogger.com/atom/ns#" term="geek moments" /><category scheme="http://www.blogger.com/atom/ns#" term="WordPress" /><title>Setting Up WordPress on a Desktop</title><content type="html">My wife is setting up her business and wants to have a website with blog, etc. Great! She'll be getting her domain name and contracting with a web hosting company - we haven't decided which at the moment.&lt;br /&gt;
&lt;br /&gt;
For the blog support, I'm going to test &lt;a href="http://wordpress.org/" target="_blank"&gt;WordPress&lt;/a&gt;, since it is very popular. Being the geek that I am, this means setting up WordPress on our home desktop machine.&lt;br /&gt;
&lt;br /&gt;
WordPress (WP) runs on top of several other popular Web tools. Apache is a free web server, PHP is a free scripting engine, and MySQL is a free database. If these tools were running together on a machine using the Linux operating system the whole stack would go by the acronym &lt;a href="http://en.wikipedia.org/wiki/LAMP_(software_bundle)" target="_blank"&gt;LAMP&lt;/a&gt;. Since I'm using a Windows PC, it will be a &lt;a href="http://en.wikipedia.org/wiki/Wamp" target="_blank"&gt;WAMP &lt;/a&gt;stack for me.&lt;br /&gt;
&lt;br /&gt;
While there are products that claim to install WP and all of these prerequisite pieces of software, I'm going to do it myself and write series of blog posts about the process.&lt;br /&gt;
&lt;br /&gt;
Wish me luck!&lt;br /&gt;
&lt;br /&gt;
ps - The process I will follow is based on&lt;a href="http://jesseforrest.name/setting-up-a-test-bench-web-server-with-apache-php-mysql-and-more-on-windows/26" target="_blank"&gt; Jessie Forrest's blog&lt;/a&gt;. Thank you Jessie for putting so much in one place! My posts will include a little background info and changes to the process Jessie posted a few years ago, based on the problems I encountered and how I solved them.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/dEGnomLnyh0" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/3973023170391667860/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=3973023170391667860" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/3973023170391667860?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/3973023170391667860?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/dEGnomLnyh0/setting-up-wordpress-on-desktop.html" title="Setting Up WordPress on a Desktop" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/setting-up-wordpress-on-desktop.html</feedburner:origLink></entry><entry gd:etag="W/&quot;A0ACSHY_cCp7ImA9WhJaFEs.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-6032960699629557233</id><published>2012-10-05T09:44:00.000-04:00</published><updated>2012-10-05T16:42:49.848-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-10-05T16:42:49.848-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="geek moments" /><title>How can a virus see?</title><content type="html">&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;&lt;a href="http://www.biology-direct.com/content....bstract" target="_blank"&gt;Proteorhodopsin genes in giant viruses&lt;/a&gt;&lt;/span&gt;&lt;br /&gt;
&lt;br /&gt;
&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;This is teh awesome! Rhodopsin is a key protein used in the eye, the first step in capturing light and turning it into sensory information. It can be found even in single celled creatures that swim towards or away from light as a feeding signal. Here, the virus is modifying the behavior of the infected cell with its own rhodopsin gene.&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;&lt;br /&gt;&lt;/span&gt;
&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;There are many examples of parasites modifying the behavior of their host. A creepy example (aren't all parasites creepy?) is the fungus that makes zombie ants leave their nest and climb up where they will get eaten, which helps the fungus spread.&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;&lt;br /&gt;&lt;/span&gt;
&lt;span style="background-color: #fefefe; font-family: Verdana; font-size: 14px; line-height: 21px;"&gt;So how do these giant viruses see with their rhodopsin gene? By making their host see for them. Giant viruses are very different from very small viruses, like the famous Ebola virus. Ebola is less than 20,000 nucleotides long (single stranded RNA) and makes only eight proteins, according to &lt;a href="http://en.wikipedia.org/wiki/Ebola_virus" target="_blank"&gt;Wikipedia&lt;/a&gt;. In contrast, mimivirus has a genome of almost 1.2 million base pairs of DNA. While Ebola just replicates as fast as possible before destroying the host cell, giant viruses are more long lived parasites.&lt;/span&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/0LQugkm6YvA" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/6032960699629557233/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=6032960699629557233" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6032960699629557233?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6032960699629557233?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/0LQugkm6YvA/how-can-virus-see.html" title="How can a virus see?" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/how-can-virus-see.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DU4GRXc9cSp7ImA9WhJaE0U.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-2241086082481124972</id><published>2012-10-04T17:58:00.000-04:00</published><updated>2012-10-04T17:58:44.969-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-10-04T17:58:44.969-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="education" /><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><category scheme="http://www.blogger.com/atom/ns#" term="ga" /><title>Evolution: A view from the 21st Century by James A. Shapiro, reviewed by David vun Kannon</title><content type="html">In this slim book, eminent bacteriologist James Shapiro attempts to communicate his view of the most important drivers of evolution for a non-specialist readership. The material is dense, mostly because the text does not rise much above an outline of all discovered processes of genetic variation, no matter how obscure.&lt;br /&gt;
&lt;br /&gt;
Shapiro succeeds in conveying the idea that variations arising from genetic change other than uniformly distributed single nucleotide changes are the most important to understanding the diversity of life today. However, his other agendas, such as displacing Crick's Central Dogma of Biology, are not successful.&lt;br /&gt;
&lt;br /&gt;
Let's deal with some of the positives of the book first.&lt;br /&gt;
&lt;br /&gt;
Shapiro is writing for a wide audience, and does not shy away from addressing some issues related to the "Intelligent Design" controversy. Some in the ID community initially took Shapiro to be their friend, in the "enemy of my enemy" sense. However, Shapiro takes the age of the planet and the evolution of life as ground facts.&lt;br /&gt;
&lt;br /&gt;
The book makes extensive use of online appendices and additional reference material. I read the book on the Nook e-reader from Barnes &amp;amp; Noble, and opening the book using the PC version of the Nook reader application made these materials easy to access. Much of the online reference material is linked directly to Pubmed. Online additional readings link mostly to articles from Scientific American - not the primary literature, but an accessible source for the expected audience. These articles span 60 years of publication and many are of historical interest only.&lt;br /&gt;
&lt;br /&gt;
The book is very complete in its coverage of genomic change processes. And while Shapiro's main point is to focus on sources of variation other than point mutation, when it comes to discuss mutation, the book includes intriguing sources such as viruses (in which mutation can happen at much higher frequencies).&lt;br /&gt;
&lt;br /&gt;
Most readers will probably be quite surprised by the importance of genomic processes other than mutation in shaping the course of evolution. Even if you've been following the developments as an interested non-professional, as I have, the variety of processes discussed is sure to teach you something new.&lt;br /&gt;
&lt;br /&gt;
One insight I got was that the machinery that is used to guide protein production inevitably interacts with the machinery of cell duplication (in single celled organisms) and germ line continuation in metazoa. I failed to see previously how often the genome is opened up and read, and how that necessary process creates the chances for things to break and be repaired differently.&lt;br /&gt;
&lt;br /&gt;
However, it must also be said that the book is far from perfect. Indeed, there are many irritations that spoil the enjoyment of learning.&lt;br /&gt;
&lt;br /&gt;
Shapiro seems to feel that it is his job to carry forward the mantle of "unorthodox biologist" worn by Lynn Margulis and Barbara McClintock, among others. He takes several shots at "evolutionists" for missing the importance of jumping genes and symbiosis, while focusing on the population genetics of single random changes.&lt;br /&gt;
&lt;br /&gt;
With all due credit to McClintock and Margulis, Shapiro's rhetorical stance is unhelpful. He does play into the hands of those that would willfully misrepresent his position by using loaded terms such as Darwinism and evolutionist, without defining them and apparently without concern with how these terms have been used in the popular press. If Shapiro means "evolutionary biologist" when he says evolutionist, he should use the less charged term.&lt;br /&gt;
&lt;br /&gt;
Shapiro repeatedly uses a "microprocessor" metaphor that is painfully inappropriate. A computer CPU is a piece of hardware that can execute any series of instructions stored in memory, given a link to the first address of where to fetch the data. The information of the genome is the data, not the hardware that reads or &amp;nbsp;acts on the data. The closest thing in the cell to a CPU is the set of molecules that read, transcribe and translate, DNA into protein - the ribosome.&lt;br /&gt;
&lt;br /&gt;
There are many ribosomes working in parallel in the cell, one of several failures of the analogy. As a system, the protein production and genetic machinery are more like a "production system" - a set of if-then rules that work in parallel. This is software, not hardware, but it fits better.&lt;br /&gt;
&lt;br /&gt;
Scientists frequently stretch to find an analogy which will work for a lay reader, to help the reader understand their work. If that is what Shapiro was trying to do, it doesn't work. If he actually thinks the genome instantiated in a cell is a microcircuit, he is sadly mistaken about microelectronics.&lt;br /&gt;
&lt;br /&gt;
Few, if any, people would call a microprocessor "aware", "intelligent", or capable of cognition, yet this book does use such aggressively telic language with respect to the cell and the genome. However, we should only be willing to talk about "cell cognition" if we are also willing to talk about "thermostat cognition". The feedback loops elaborated in the cell are only marginally more complex than your friendly household appliance.&lt;br /&gt;
&lt;br /&gt;
Darwin comes in for some criticism that seems unnecessary, sort of like criticising Newton for not discussing relativity. Yes, Darwin's uniformitarianism was/is a simplification of what we know today, and did reflect philosophical debates of his time. So what? Does this need to be criticised or simply acknowledged?&lt;br /&gt;
&lt;br /&gt;
Repeatedly when dismissing the random mutation of single nucleotides, Shapiro seems to confuse random with 'uniformly distributed' - or read that confusion onto others. We know that SNPs (single nucleotide polymorphisms) are not randomly distributed. They are more likely in some parts of the DNA string than in others. However, they are random, in the sense that we don't know in advance where a change will take place, even if we know they take place at different frequencies. As an analogy, we know that a sample of a radioactive element has a half-life, but we don't know which atom will decay next.&lt;br /&gt;
&lt;br /&gt;
Shapiro seems unconcerned with the Darwinian distinction between selection and sources of variation, giving all the credit to the multiple sources of variation, and little or none to the various forms of selection that can act on an organism. There is also no discussion of the "evolution of evolvability" as a framework for understanding the many mechanisms that are cataloged in the book.&lt;br /&gt;
&lt;br /&gt;
A weakness in the writing is to describe the genetic machinery as "indescribably complex" before launching into a description of it! Phrases like 'indescribably complex' are just more fodder for quote mining by creationists. Similarly, Shapiro's overall anti-reductionist stance obscures the fact that all of the data and research are based on a reductionist paradigm - the genetic machinery of the cell is entirely the arrangement of atoms and the forces acting upon them, as is everything else in the cell. There is no vital elixir or special sauce that defies reduction to these terms.&lt;br /&gt;
&lt;br /&gt;
While referring to it several times, Shapiro never successfully attacks the Central Dogma of Biology, that information flows in the direction of DNA to RNA to protein, but not in reverse. There are ample examples given of proteins attaching to and regulating the genome, but those proteins are always created by the genome.&lt;br /&gt;
&lt;br /&gt;
Relevance to the ID debate&lt;br /&gt;
&lt;br /&gt;
The book does mention Intelligent Design. However, it also treats evolution as a fact. Natural genetic engineering, as Shapiro calls it, is the source of variation used by evolution. These large scale additions and rearrangements are the driver of metazoan evolution - not new sequences.&lt;br /&gt;
&lt;br /&gt;
It has been the mistake of ID supporters to try to find an ally in Shapiro. Obviously, they did not read the whole book, or if they did their memory is quite selective as to its contents.&lt;br /&gt;
&lt;br /&gt;
It should be mentioned that Shapiro published two papers with controversial ID figure Dr. Richard von Sternberg in 2005. Sternberg is thanked in the acknowledgements.&lt;br /&gt;
&lt;br /&gt;
Shapiro also indulges in some 'bignum' argumentation. This is the sort of handwaving probability calculation that concludes that "there is not enough time" for base-by-base change to create the evolutionary results we see. This kind of reasoning has often been proved wrong, usually by pointing out that sexual reproduction allows many changes to be selected in parallel throughout a population and combined, and high rates of reproduction and HGT (horizontal gene transfer) accomplishing the same thing in bacteria.&lt;br /&gt;
&lt;br /&gt;
Indeed, Shapiro's own discussion of viruses as sources of variation for other life does not examine the sources of variation in viruses - uncorrected random mutation.&lt;br /&gt;
&lt;br /&gt;
The telic language, anti-"Darwinism", and "gee, its complicated" attitude are all ID friendly, but in the end Shapiro has a clear vision of who the Intelligent Designer is, and it is the cell itself.&lt;br /&gt;
&lt;br /&gt;
Relation to the GA software paradigm&lt;br /&gt;
&lt;br /&gt;
Much of conventional Genetic Algorithm software is explicitly point mutation based. Mutation and crossover are often the only operators used, and usually mutation is uniform along the genome. This is the strawman view of genetics that Shapiro criticizes most sharply.&lt;br /&gt;
&lt;br /&gt;
I think the book can be read as a set of suggestions for improving our GA algorithm design if we want to&amp;nbsp;achieve&amp;nbsp;more than numerical optimization with GA. Here are some taking off points that I see:&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;ul&gt;
&lt;li&gt;exon/intron distinctions, and redundant representations&lt;/li&gt;
&lt;li&gt;germ/soma distinctions&lt;/li&gt;
&lt;li&gt;both of the above presuppose a more robust genotype/phenotype distinction&lt;/li&gt;
&lt;li&gt;development of that phenotype aka evo-devo GAs&lt;/li&gt;
&lt;li&gt;fitness testing at multiple points during a phenotype's lifetime&lt;/li&gt;
&lt;li&gt;gene regulatory networks -&amp;nbsp;genetic operators for regulation of the genome&lt;/li&gt;
&lt;/ul&gt;
&lt;br /&gt;
&lt;br /&gt;
In conclusion, a book well worth reading and thinking about, even with the annoyances and&amp;nbsp;idiosyncrasies&amp;nbsp;of the author.&lt;br /&gt;
&lt;br /&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/jWvfDHfMycw" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/2241086082481124972/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=2241086082481124972" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2241086082481124972?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2241086082481124972?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/jWvfDHfMycw/evolution-view-from-21st-century-by.html" title="Evolution: A view from the 21st Century by James A. Shapiro, reviewed by David vun Kannon" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/evolution-view-from-21st-century-by.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CkEMRXw6fSp7ImA9WhJaEUw.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-6712189465938437342</id><published>2012-10-01T12:58:00.000-04:00</published><updated>2012-10-01T12:58:04.215-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-10-01T12:58:04.215-04:00</app:edited><title>Freestyles!</title><content type="html">I wrote previously that my wife and I were attending the Arthur Murray "Freestyles" event that was held yesterday, so this post is report on that event.&lt;br /&gt;
&lt;br /&gt;
Wow! It has a lot of fun, a whole day of dancing and socializing with our friends from the Arthur Murray dance studio in Montclair. At a Freestyles event, several Arthur Murray studios get together to give students a venue to perform for a judge, in order to receive impartial feedback. It is not a competitive event, and the emphasis for beginning students (like us) is on performing the syllabus figures for your level, either without additional choreography (closed) or with (open).&lt;br /&gt;
&lt;br /&gt;
Yesterday's Freestyles was held at the Bridgewater Marriott, a centrally located venue for the Arthur Murray studios of Montclair, Kenilworth, Whitehouse Station, and Princeton. The event was well organized. The dancing was by 'heats' of several couples at once on the floor, all dancing the same dance, though each couple was dancing their own choice of steps. Each heat also had a variety of skill levels, and while there were no collisions it was clearly the responsibility of the better dancers and instructors to avoid the less skilled.&lt;br /&gt;
&lt;br /&gt;
Blanka and I had chosen to dance four dances (Rumba, Cha-Cha, Foxtrot, and Tango) both together and with our instructors. As a result, we were each on the floor eight times, across twelve different heats. It was very nice that we were not in the same heat while dancing with our instructors, because we got to enjoy watching each other dance.&lt;br /&gt;
&lt;br /&gt;
The actual dancing was wonderful, without much anxiety about forgetting steps, losing timing, or stepping on the dress of the lady next to me. We had practiced so much leading up to the event that it was almost second nature to dance the dances that we had chosen, and we did dance them 'freestyle', without repeating a set sequence.&lt;br /&gt;
&lt;br /&gt;
As the day progressed, it was obvious that we had taken a very cautious approach to participating in the event. Many students danced multiple heats of the same dance, open and closed, for many more than four dances! There were 166 (!!) heats during the day, so we were sitting and cheering our friends on for most of the day. Next time, we'll know to push ourselves to dance more.&lt;br /&gt;
&lt;br /&gt;
The day included lunch, dinner, a pro show by the instructors from each studio, and casual dancing after dinner. We were quite tired by the end of the evening, and I can't imagine where some of the instructors got their energy, dancing heat after heat with their students.&lt;br /&gt;
&lt;br /&gt;
We had a great time.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/FLeeybxZLFg" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/6712189465938437342/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=6712189465938437342" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6712189465938437342?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6712189465938437342?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/FLeeybxZLFg/freestyles.html" title="Freestyles!" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/10/freestyles.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CEAGRXY5cCp7ImA9WhJbGUo.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-8178545398228507678</id><published>2012-09-29T22:27:00.000-04:00</published><updated>2012-09-29T22:38:44.828-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-09-29T22:38:44.828-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="fun" /><category scheme="http://www.blogger.com/atom/ns#" term="dance" /><category scheme="http://www.blogger.com/atom/ns#" term="geek moments" /><title>Getting the Most from your Arthur Murray Dance Package</title><content type="html">My wife, Blanka, and I have been dancing at the Arthur Murray studio in Montclair, NJ for a little less than a year. It all began as a birthday present from her of a few private lessons, but it has grown into an important part of our life and growth within the Montclair community.&lt;br /&gt;
&lt;br /&gt;
Put simply, the people and staff of the dance studio are wonderful. We have met so many people from different backgrounds that we otherwise would never have met. Our instructors, Gregory and Emma, are simply the best. They are fantastic at communicating quickly and clearly, and giving us maximum value in each 40 minute lesson.&lt;br /&gt;
&lt;br /&gt;
If you are also interested in learning to dance through the Arthur Murray system, or you are in the process of comparing studios, here are a few of the things we have learned that will help you maximize your enjoyment, progress, and value of your purchase.&lt;br /&gt;
&lt;ul&gt;
&lt;li&gt;Buy a package of lessons if you can afford it. It helps lower the total cost and increases your commitment to continuing.&lt;/li&gt;
&lt;li&gt;Stay an informed consumer, and manage your package to make sure you are learning the dances you want. Ask questions and give feedback. You're paying a lot of money to the studio, make sure you feel that you are getting your money's worth.&lt;/li&gt;
&lt;li&gt;At the same time, I can't emphasize enough how helpful it has been for me to spend entire private lessons just on the basics of framing and leading that are fundamental to every dance. Creating a connection with another person on the dance floor is probably the best part of dancing! Don't cheat yourself out of it by making the mistake of focusing on memorizing steps. That will come at its own pace. The body awareness of your dance frame and the 'other' awareness of your lead (or follow) skills are the most important benefits of dancing - they will extend far into other parts of your life.&lt;/li&gt;
&lt;li&gt;Take advantage of all the free training that Arthur Murray studios give you. Attend at least one group lesson and practice party a week.&lt;/li&gt;
&lt;li&gt;Come early to your lesson and warm up. Practice time is also free! This is an important benefit that I don't see a lot of students taking advantage of. You'll get more out of your lesson time if you've warmed up and practiced a bit on your own beforehand.&lt;/li&gt;
&lt;li&gt;Keep a dance journal. We were told that more serious students did this, and now that we do it also, we can see the benefits. It really helps to review what you've learned, and writing out the ideas by hand helps you remember them better. We haven't got to the point of videoing our steps, but it could happen!&lt;/li&gt;
&lt;li&gt;Make friends and have fun. You are there to have fun, right? Moving to music is a pure, visceral joy. Everyone else is also there to have fun. Smile at all your dance partners in group lessons. Our studio is blessed with a diverse student body, and I think mutual encouragement is important to keeping everyone coming.&lt;/li&gt;
&lt;/ul&gt;
&lt;br /&gt;
&lt;br /&gt;
I hope your studio does not pressure you to participate in additional activities. These balls, festivals, showcases, or competitions are completely extra - do them if they make sense to you, at your comfort level. Don't respond to any high-pressure sales tactics, and if you experience such tactics from your instructor or the studio owner tell them directly that it is inappropriate when you've already committed to spending thousands of dollars with them. (I'm saying that I've experienced anything like this at our studio, but I have read some horror stories on the web...)&lt;br /&gt;
&lt;br /&gt;
Tomorrow, Blanka and I dance in our first "Freestyles" and we are thrilled to do it, having passed up several earlier opportunities that were available to us. Now we are ready, and now we will have fun. We've geared up, bought some extra 'bling' for each of us and we're looking forward to showing off our skills and getting some constructive feedback on our progress. It is going to be a great, fun day! I hope you have a lot of fun days during your dance experience, and I hope these tips will help you.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/KpaxxpXAZsg" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/8178545398228507678/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=8178545398228507678" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/8178545398228507678?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/8178545398228507678?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/KpaxxpXAZsg/getting-most-from-your-arthur-murray.html" title="Getting the Most from your Arthur Murray Dance Package" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/09/getting-most-from-your-arthur-murray.html</feedburner:origLink></entry><entry gd:etag="W/&quot;AkQBSXs7fip7ImA9WhJTEU8.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-6161084581031677759</id><published>2012-06-19T13:52:00.000-04:00</published><updated>2012-06-19T13:52:38.506-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-06-19T13:52:38.506-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="Barham" /><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><title>Barhaminology: The Bioessentialist Manifesto</title><content type="html">Over at his TheBestSchools.org blog, James Barham continues to entertain us with armchair philosophy. In this episode, his view of what biology is really all about.&lt;br /&gt;
&lt;br /&gt;
Barham sets up two views, the Darwinian view, and the bioessentialist view. Guess which one he prefers?&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;blockquote class="tr_bq"&gt;
&lt;em&gt;The Darwinian View of Life&lt;/em&gt;&lt;ul style="font-family: Georgia, Times, 'Times New Roman', serif; font-size: 12px; line-height: 23px;"&gt;
&lt;li&gt;There is no deep difference between living and nonliving matter; therefore, it is idle to seek “essential” properties or a “definition” of life.&lt;/li&gt;
&lt;/ul&gt;
&lt;ul style="font-family: Georgia, Times, 'Times New Roman', serif; font-size: 12px; line-height: 23px;"&gt;
&lt;li&gt;In any case, the most fundamental fact about a living thing is its ability to undergo natural selection.&lt;/li&gt;
&lt;/ul&gt;
&lt;/blockquote&gt;
&lt;div&gt;
&lt;blockquote class="tr_bq"&gt;
&lt;em&gt;The Bioessentialist View of Life&lt;/em&gt;&lt;ul style="font-family: Georgia, Times, 'Times New Roman', serif; font-size: 12px; line-height: 23px;"&gt;
&lt;li&gt;There is a fundamental difference in kind between living and nonliving systems; the main task of biology is to understand the distinctive nature of living matter.&lt;/li&gt;
&lt;/ul&gt;
&lt;ul style="font-family: Georgia, Times, 'Times New Roman', serif; font-size: 12px; line-height: 23px;"&gt;
&lt;li&gt;The most fundamental fact about a living thing is its ability,&amp;nbsp;&lt;em&gt;by doing work selectively&lt;/em&gt;, to maintain itself in existence as the kind of physical system that it is.&lt;/li&gt;
&lt;/ul&gt;
&lt;/blockquote&gt;
&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;Dismiss in passing Barham's purposeful confusion of Darwinism and materialism. Let's go to the videotape! Anyone remember the search for elan vital? It doesn't exist. Living things are made of the same atoms as non-living things. Use the same chemical reactions. Watch the same TV shows. Mr Barham seems to have forgotten that.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;Oh, sorry, I didn't notice that the Darwinian was looking at 'matter' and the bioessentialist was looking at 'systems'. For a philosopher, Barham has a tough time setting up his comparisons.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;"The main task of biology" - James Barham, armchair philosopher and web technician, has pronounced. It must be so.&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="font-family: inherit;"&gt;"&lt;em style="background-color: white; line-height: 23px;"&gt;by doing work selectively&lt;/em&gt;&lt;span style="background-color: white; line-height: 23px;"&gt;," - selectively? A bacteria only eats half the available sugar? A virus only makes half the copies of itself that it could? Sperm cells only swim as much as they want? Barham might work selectively but it hardly qualifies as a definition of life.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;(My own definition of life, FWIW: Life is a collection of molecules working together to avoid equilibrium for as long as possible.)&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;The essay is quite long and continues to be silly in the same vein. Genes are contrasted with proteins because metabolism is more important than reproduction. WTF? Since when was living forever an option? Metabolism explains the fossil record, biodiversity, the peacock's feathers and the panda's thumb?&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;Barham and his dog Marty are not, apparently, made of quarks descended from the Big Bang. Perhaps they were specially created 6,000 years ago. Who knew? Marty ain't made from no quarks! Reductionism is defeated.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;blockquote class="tr_bq"&gt;
&lt;span style="font-family: Georgia, Times, 'Times New Roman', serif; font-size: 12px; line-height: 23px;"&gt;For example, they are all explained at a more fundamental level by the Pauli exclusion principle.&lt;/span&gt;&lt;/blockquote&gt;
&lt;span style="line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;Except when it is convenient.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;br /&gt;
&lt;blockquote class="tr_bq"&gt;
In the case of a true machine, the functional order has nothing whatever to do with the matter out of which the machine is composed. It is imposed upon the matter entirely from without—by us. The material parts out of which a machine is made are supremely indifferent to the purpose the whole is designed by us to serve. Moreover, the stability of a machine resides in the rigidity—not the flexibility, much less the inherent intelligence—of its parts.&lt;br /&gt;In contrast to what happens inside a machine, everything that goes on within a living being possesses an inherent purpose—namely, maintaining the organism in existence. That is the essential difference between living and nonliving things.&lt;/blockquote&gt;
&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;So living things are NOT machines. Just don't tell Polanyi and all those folks that want to argue that living things ARE machines, because machines are designed.&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;span style="background-color: white; line-height: 23px;"&gt;&lt;span style="font-family: inherit;"&gt;Don't quit the web job, James. Armchair philosophy, it ain't for you.&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/cSwMeUZI6i4" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/6161084581031677759/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=6161084581031677759" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6161084581031677759?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6161084581031677759?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/cSwMeUZI6i4/barhaminology-bioessentialist-manifesto.html" title="Barhaminology: The Bioessentialist Manifesto" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/06/barhaminology-bioessentialist-manifesto.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DEACSXgyfyp7ImA9WhVaEUU.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-2743825466248658353</id><published>2012-06-08T16:05:00.001-04:00</published><updated>2012-06-08T16:19:28.697-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-06-08T16:19:28.697-04:00</app:edited><title>Someone Teach Ann Gauger to Google</title><content type="html">&lt;div dir="ltr"&gt;
&lt;span style="font-family: inherit;"&gt;Over at the blog of the Biologic Institute (the Discovery Institute's science-y wing), Ann Gauger has been writing regularly about molecules. Her April 30th post, Intricate Coordination, looked at the enzyme&amp;nbsp;&lt;span style="background-color: white; line-height: 20px;"&gt;carbamoyl phosphate synthetase (CPS). Wow! CPS is complicated! It has two parts, three active sites, and an intramolecular tunnel. And here is Ann's take-away message:&lt;/span&gt;&lt;/span&gt;&lt;br /&gt;
&lt;div&gt;
&lt;span style="background-color: white; font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;blockquote style="border: none; margin: 0 0 0 40px; padding: 0px;"&gt;
&lt;div&gt;
&lt;span style="background-color: white; font-family: inherit; line-height: 20px;"&gt;How does a neo-Darwinian process evolve an enzyme like this? Even if enzymes that carried out the various partial reactions could have evolved separately, the coordination and combining of those domains into one huge enzyme is a feat of engineering beyond anything we can do.&amp;nbsp;&lt;/span&gt;&lt;/div&gt;
&lt;/blockquote&gt;
&lt;div&gt;
&lt;span style="background-color: white; font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;Well, how do we explain this?&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;First, by understanding that CPS is not a singular 'thing'. Like any biomolecule of any size, it comes in a variety of shapes and sizes throughout the different species of life. In fact, CPS performs an important role in the cell, and is therefore&lt;a href="http://mbe.oxfordjournals.org/content/13/7/970.full.pdf" target="_blank"&gt; found across Bacteria, Archaea, and Eukarya&lt;/a&gt;. &lt;a href="http://eppserver.ag.utk.edu/personnel/Moulton/Moulton_Pubs/Eremoneura%20MPE.pdf" target="_blank"&gt;We can use CPS to draw a phylogeny, a tree of life&lt;/a&gt;. So the first part of an answer to Ann is yes, CPS does evolve. Evolution is the simplest explanation of the many versions of CPS found throughout living species.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;Second, we can see that Ann's question is really a sense-of-wonder question. Parts, sites, a tunnel, a &amp;nbsp;lab under an extinct volcano, sharks with lasers, it is all so amazing. Yes, it is, even if it doesn't have those last two items. But "substrate channeling", as the cool kids call it, isn't unique to CPS. &lt;a href="http://www.jbc.org/content/274/18/12193.long" target="_blank"&gt;Lots of enzymes do it&lt;/a&gt;. Sometimes they use a tunnel of hydrophobic residues, sometimes hydrophillic residues. Sometimes the 'tunnel' is more of a path of favorable charges across the surface of the enzyme, sometimes it is a floppy arm that carries substrates from one place to another as it flops around. Not only has it evolved, it has evolved multiple times for different substrates.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;These different functional mechanisms help to keep reactants from floating off into the cytoplasm, thereby increasing the speed and efficiency of an enzyme. AA residues facing into the tunnel can effect the speed with which molecules diffuse down its length, keeping the different parts of the reaction in sync. These qualify as huge selective pressures, so the second part of an answer to Ann is that evolution created these enzymes using the standard preference for higher functioning processes. Natural selection, you've heard of it, right?&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;Thirdly, we can understand the question to be one of, 'from what functional predecessor did CPS evolve?" If we look at CPS across the various species, it comes in two parts with separate functions, so right there we can see that these parts could have evolved separately, from less specialized or efficient predecessors. The larger of the two subunits, the part with two active sites, seems to have undergone a gene duplication event very early in its history. This subunit seems to have&lt;a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC24219/" target="_blank"&gt; developed from a carbamate-kinase ancestor&lt;/a&gt;.&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;Putting it together, an answer to Ann's question is "Yes, CPS does evolve, by normal functional selection, from clear ancestors via well understood variational events."&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;"...&lt;/span&gt;&lt;span style="background-color: white; line-height: 20px;"&gt;&amp;nbsp;&lt;/span&gt;&lt;span style="background-color: white; line-height: 20px;"&gt;a feat of engineering beyond anything we can do"? Ummm, no. Looking at the phylogeny, pretty much any branch is a sequence of exaptations, duplications, fusions, mutations, wash, rinse, repeat. Yeah, we can do that. As a matter of fact, we do do that. We've been &lt;a href="http://www.jbc.org/content/277/42/39722.full.pdf" target="_blank"&gt;poking at CPS&lt;/a&gt; for a while, pulling the genes apart, putting them back together, mutating it. It is the basic path to understanding how CPS works.&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="line-height: 20px;"&gt;Now I will make a confession. I am not a biochemist or an evolutionary molecular biologist. But I do know how to use &lt;a href="https://www.google.com/" target="_blank"&gt;Google&lt;/a&gt;. Starting from "evolution&amp;nbsp;&lt;/span&gt;&lt;span style="background-color: white; line-height: 20px;"&gt;carbamoyl phosphate synthetase" and ending with "evolution substrate channeling" I learned a lot about CPS very quickly, mostly with the help of papers published in the 1990's. Google is your friend. PubMed is your friend.&amp;nbsp;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="background-color: white; font-family: inherit; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="font-family: inherit;"&gt;&lt;span style="background-color: white; line-height: 20px;"&gt;Friends don't let friends blog stupid. Don't follow the path of Cornelius Hunter, he of the "Stuff's Complicated, Must Be Jeeebus" blog tic.&amp;nbsp;&lt;/span&gt;&lt;span style="background-color: white; line-height: 20px;"&gt;Think about it, Ann.&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;
&lt;div&gt;
&lt;span style="color: #3c3c36; font-family: 'Helvetic Neue', Helvetica, Arial, sans-serif;"&gt;&lt;span style="font-size: 12px; line-height: 20px;"&gt;&lt;br /&gt;&lt;/span&gt;&lt;/span&gt;&lt;/div&gt;
&lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/h8dkGWYSx5A" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/2743825466248658353/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=2743825466248658353" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2743825466248658353?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2743825466248658353?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/h8dkGWYSx5A/someone-teach-ann-gauger-to-google.html" title="Someone Teach Ann Gauger to Google" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/06/someone-teach-ann-gauger-to-google.html</feedburner:origLink></entry><entry gd:etag="W/&quot;AkUMQ3Y7fCp7ImA9WhVbFUo.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-683759572649872386</id><published>2012-06-01T15:18:00.000-04:00</published><updated>2012-06-01T15:18:02.804-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-06-01T15:18:02.804-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="global warming" /><title>No trend in tornadoes</title><content type="html">This is my first post dipping a toe into the churning waters of climate change/global warming.&lt;br /&gt;
&lt;br /&gt;
I saw a pretty visualization over at WUWT of tornado storm tracks, and decided to follow up with looking at the data myself. It is all available from the NOAA Storm Prediction Center site. (I normally go to WUWT for the comedy. The few earnest&amp;nbsp;skeptics&amp;nbsp;are mixed in with a vast number of loons.)&lt;br /&gt;
&lt;br /&gt;
To estimate the energy of a single tornado, I multiplied the track length * the track width * (F+2)^1.5. This gave me a number I felt it was safe to add up across all tornadoes in a year.&lt;br /&gt;
&lt;br /&gt;
Looking at all tornadoes, or at just the severe F4+F5 subset, I did not see any trend in the data when charted in Excel. That is my rough, first pass observation. There certainly are more tornado observations as time passes, but seeing many more small tornadoes isn't changing the big picture much.&lt;br /&gt;
&lt;br /&gt;
Why might that be? Well, one thing that I can think of is that, as spectacular as tornadoes are, they don't actually account for a lot of energy. Or the GW effect might be to shift where and when the occur, not the strength when they do. Actual strength might be limited by some other constraint of atmospheric physics.&lt;br /&gt;
&lt;br /&gt;
As I said above, there are many more tornadoes reported now compared to decades ago. Many commentators put this down to better observational data, the growth of populations in tornado prevalent areas, etc. If there is a GW aspect to number of&amp;nbsp;tornadoes, it will be difficult to untangle from these issues.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/15PRw5ysuoY" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/683759572649872386/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=683759572649872386" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/683759572649872386?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/683759572649872386?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/15PRw5ysuoY/no-trend-in-tornadoes.html" title="No trend in tornadoes" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/06/no-trend-in-tornadoes.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DEABR38-cSp7ImA9WhVbFEQ.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-6975239202896036957</id><published>2012-05-31T16:39:00.001-04:00</published><updated>2012-05-31T16:39:16.159-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-05-31T16:39:16.159-04:00</app:edited><title>TheBestSchools.org joins the Discovery Institute link farm</title><content type="html">&lt;div dir='ltr'&gt;      &lt;style&gt;&lt;!--  .hmmessage P  {  margin:0px;  padding:0px  }  body.hmmessage  {  font-size: 10pt;  font-family:Tahoma  }  --&gt;&lt;/style&gt;  &lt;div dir="ltr"&gt;For a while, Uncommon Descent's resident flack (Denyse O'Leary) has linked in several blog entries from TheBestSchools.org's blog. TBS appears to be a web resource&amp;nbsp;targeted&amp;nbsp;at Christians choosing a college. The main site mixes articles on the 10 Best Nursing Programs with interviews with folks such as William Lane Craig. The blog, however, seems to be the sole province of James Barham.&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;br&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;Well, it used to be the sole province of James Barham. Now Denyse herself has begun posting there, and Barham's posts have begun cross-posting between TBS and the Discovery Institute's Evolution News and Views site.&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;br&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;I had hopes for TBS, since it seemed to allow comments and Barham seemed to be a nice fellow posting on intellectually interesting topics. Alas, after I registered and tried to post a comment it went from moderation to deletion without seeing the light of day. At this point, I would consider TBS (the blog at least) to be just another corner of the DI link farm.&lt;br&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;/div&gt;   		 	   		  &lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/-ONkySTA4c8" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/6975239202896036957/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=6975239202896036957" title="2 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6975239202896036957?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/6975239202896036957?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/-ONkySTA4c8/thebestschoolsorg-joins-discovery.html" title="TheBestSchools.org joins the Discovery Institute link farm" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>2</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/05/thebestschoolsorg-joins-discovery.html</feedburner:origLink></entry><entry gd:etag="W/&quot;D0cBRHY5eip7ImA9WhVbE08.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-113951470945319707</id><published>2012-05-29T16:57:00.001-04:00</published><updated>2012-05-29T16:57:35.822-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-05-29T16:57:35.822-04:00</app:edited><title>When there is no good news for ID, quote an old book</title><content type="html">&lt;div dir='ltr'&gt;      &lt;style&gt;&lt;!--  .hmmessage P  {  margin:0px;  padding:0px  }  body.hmmessage  {  font-size: 10pt;  font-family:Tahoma  }  --&gt;&lt;/style&gt;  &lt;div dir="ltr"&gt;It is a slow news day over at UncommonDescent. Actually, every day is a slow news day there, since there are no ID scientists doing ID research publishable in peer reviewed journals. So the UD news desk, Denyse O'Leary, dips into the pages of John Sanford's Genetic Entropy for an extended quote.&lt;div&gt;&lt;br&gt;&lt;/div&gt;&lt;blockquote style="margin: 0 0 0 40px; border: none; padding: 0px;"&gt;&lt;div&gt;&lt;span style="font-family: Verdana, Geneva, sans-serif; font-size: 12px; line-height: 18px; background-color: rgb(228, 231, 245); "&gt;During the last century, there was a great deal of effort invested in trying to use mutation to generate useful variation. This was especially true in my own area – plant breeding. When it was discovered that certain forms of radiation and certain chemicals were powerful mutagenic agents, millions and million of plants were mutagenized and screened for possible improvements. Assuming the Primary Axiom (that the secies are merely the product of random mutations plus natural selection), it would seem obvious that this would result in rapid "evolution" of our crops. For several decades this was the main thrust of crop improvement research. Vast numbers of mutants were produced and screened, collectively representing many billions of mutation events. A huge number of small, sterile, sick, deformed, aberrant plants were produced. However, from all this effort, essentially no meaningful crop improvement resulted. The entire effort was a failure, and was eventually abandoned. –&amp;nbsp;&lt;/span&gt;&lt;a href="http://www.amazon.com/Genetic-Entropy-The-Mystery-Genome/dp/0981631606" target="another" style="margin: 0px; padding: 0px; font-family: Verdana, Geneva, sans-serif; font-size: 12px; line-height: 18px; background-color: rgb(228, 231, 245); "&gt;&lt;em style="margin: 0px; padding: 0px; "&gt;Genetic Entropy &amp;amp; the Mystery of the Genome&lt;/em&gt;&lt;/a&gt;&lt;span style="font-family: Verdana, Geneva, sans-serif; font-size: 12px; line-height: 18px; background-color: rgb(228, 231, 245); "&gt;&amp;nbsp;, page 25&lt;/span&gt;&lt;/div&gt;&lt;div&gt;&lt;span style="font-family: Verdana, Geneva, sans-serif; font-size: 12px; line-height: 18px; background-color: rgb(228, 231, 245); "&gt;&lt;br&gt;&lt;/span&gt;&lt;/div&gt;&lt;/blockquote&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;It is an interesting quote, and I'd like to address the ideas in it by referencing the development of high-yielding varieties of wheat and rice during the Green Revolution, work which took place during the same approximate time as Sanford refers to.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;First, let us note that Sanford is going to trade upon the ambiguity in his phrase "random mutations plus natural selection". RM+NS, as it is often abbreviated in internet dialogs, can mean either any kind of genomic variation and any kind of selective pressure, or only the substitution of exactly one nucleotide for another in DNA and the survival of the fittest. When making a claim against "Darwinism" or "evolutionism" opponents imply the first, broad meaning. When asked to defend a claim, they retreat to the narrow meaning.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;No modern scientist thinks nucleotide substitution alone built the genomes of every species alive, and those extinct. Reading the genomes of many species has shown how &amp;nbsp;groups of genes have been duplicated as groups, sometimes across species boundaries. Importantly for the case of useful plants, the entire genome of plants such as wheat and potatos has been duplicated more than once. Each cell of a wheat plant has six complete copies of its genome! These large scale restructurings are responsible for the rapid change in plant and animal evolution, compared to bacterial evolution.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;Second, if we look at the Green Revolution - the rapid expansion of crop productivity around the world since World War II - we see that the main driver was new kinds of wheat and rice. These new cultivars grew shorter stems, which were mechanically stronger than previous wild-type long stems. The strength of the stem was important when the seed head grew bigger. Without a strong stem, the plant fell over (lodged).&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;The short stems are the result of point mutations in the genome. We've known this for a long time. We know that the mutations affect the growth signal processes, stunting growth compared to the wild-type plant. So Sanford is flat wrong to suggest that we have never found beneficial mutations in plants. He has a fig leaf to hide behind in that these mutations were found in naturally growing variants of wheat and rice. They were not induced by human radiation or chemical experiments.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;Since we now know the size of the wheat genome, we could calculate the expected time until discovery of a beneficial mutation, using the techniques of radiation and chemical mutagenesis. I'm going to guess it would be on the order of millions of years, if each batch of seeds has to be grown and tested for increased function.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;This is an essential contrast between the small bodied, asexual evolution of bacteria and the large bodied, sexual evolution of plants and animals. We do see rapid response to chemical stresses, such as anti-biotic resistance, in bacteria because the population being stressed is trillions of individuals. We can't test a population of trillions of plants or animals. Perhaps Sanford hasn't thought about the implications of that, or perhaps he has and would prefer to obfuscate them.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;&lt;br&gt;&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;&lt;div dir="ltr"&gt;&lt;font face="Verdana, Geneva, sans-serif"&gt;&lt;span style="font-size: 12px; line-height: 18px;"&gt;The idea that exposing pollen grains to radiation would advance the species is 'hopeful monster' thinking. That said, it worked! Dwarf wheat and rice have fed billions of people. Sanford's pessimism is misplaced.&lt;/span&gt;&lt;/font&gt;&lt;/div&gt;   		 	   		  &lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/BAY3E5i78_A" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/113951470945319707/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=113951470945319707" title="2 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/113951470945319707?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/113951470945319707?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/BAY3E5i78_A/when-there-is-no-good-news-for-id-quote.html" title="When there is no good news for ID, quote an old book" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>2</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/05/when-there-is-no-good-news-for-id-quote.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CEQGSH49cCp7ImA9WhVUF0U.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-9182901870992584652</id><published>2012-05-23T10:12:00.000-04:00</published><updated>2012-05-23T10:12:09.068-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-05-23T10:12:09.068-04:00</app:edited><title>Graceland</title><content type="html">Blanka and I drove down to Memphis last week to spend some time with my Dad and his wife Doris. We had a great time. It was the first time I had been in Memphis since childhood.&lt;br /&gt;
We visited two places on our own, Graceland, and the National Civil Rights Museum.&lt;br /&gt;
&lt;br /&gt;
Graceland, as most of the planet knows, is the home of the second best musician to graduate from Humes High School. (My father being number one, of course.) There was plenty of over the top Elvis worship on display, but it was enjoyable and a good introduction to the music and times Elvis shaped.&lt;br /&gt;
&lt;br /&gt;
A different take on the same period was the NCRM. The museum preserves the facade of the Lorraine Motel, the site of Dr. Martin Luther King Jr.'s assassination. The museum exhibits wind back and forth, and rise by carefully placed ramps until suddenly you are there, looking out of the window of room 307, right next to Dr. King's 306.&lt;br /&gt;
&lt;br /&gt;
The museum is a powerful testimony to the civil rights struggle. One of the best parts, in my view, was the short film, "The Witness". Narrated for the most part by Rev. Billy Kyles, who was standing just a few feet from Dr. King when he was killed, the film gives the context for the events that brought Dr. King to Memphis.&lt;br /&gt;
&lt;br /&gt;
The film is extremely effective and emotional. I highly recommend it. I purchased a copy in the museum store, and it has been uploaded to vimeo (not sure of the legality of that, though).&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/vlOZJSPFIUI" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/9182901870992584652/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=9182901870992584652" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/9182901870992584652?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/9182901870992584652?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/vlOZJSPFIUI/graceland.html" title="Graceland" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/05/graceland.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CUQCQ3gycCp7ImA9WhVVEUs.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-7726398811166068519</id><published>2012-05-04T16:29:00.001-04:00</published><updated>2012-05-04T16:29:22.698-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-05-04T16:29:22.698-04:00</app:edited><title>Superconductivity and Intelligent Design</title><content type="html">I was reading a recent article on the very cool topic of&lt;a href="http://spectrum.ieee.org/semiconductors/materials/topological-insulators/"&gt; topological insulators&lt;/a&gt; when it reminded me of an interesting period of time.&lt;br /&gt;
&lt;br /&gt;
Superconductivity, the phenomenon of complete absence of electrical resistance, was first observed by Heike Kamerlingh Onnes in 1911. The observation was readily repeatable, and Onnes won the 1913 Nobel Prize in Physics for its discovery. However, for nearly 50 years there was no theoretical explanation that really satisfied the physics community. But during the 1950s the BCS theory of Cooper pairs of electrons acting as phonons was developed that described a mechanism for superconductivity.&lt;br /&gt;
&lt;br /&gt;
Never, to my knowledge, did the physics community assume intelligent design was the answer for why superconductivity existed. There was not naturalistic explanation for 50 years, yet they never lobbied for a supernatural explanation as the 'default' or inference to the 'best' explanation. I wonder why that is?&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/XBvNcylXc3M" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/7726398811166068519/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=7726398811166068519" title="4 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/7726398811166068519?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/7726398811166068519?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/XBvNcylXc3M/superconductivity-and-intelligent.html" title="Superconductivity and Intelligent Design" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>4</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/05/superconductivity-and-intelligent.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CEIFRHY_eip7ImA9WhVVEUs.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-2404357403000961635</id><published>2012-05-04T16:15:00.002-04:00</published><updated>2012-05-04T16:15:15.842-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-05-04T16:15:15.842-04:00</app:edited><title>Going Green</title><content type="html">We just purchased a &lt;a href="http://defineyourspace.com/eangee/product_detail.php?i=395%20xl%20g" target="_blank"&gt;beautiful floor lamp&lt;/a&gt; at the &lt;a href="http://www.thezenshopstores.com/" target="_blank"&gt;Zen Shop&lt;/a&gt; in Riverside Square Mall.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;div class="separator" style="clear: both; text-align: center;"&gt;
&lt;a href="http://defineyourspace.com/eangee/images/395-xl-g.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="320" src="http://defineyourspace.com/eangee/images/395-xl-g.jpg" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;
The vertical poles are dark stained bamboo, and the panels are real cocoa (chocolate tree) leaves. It looks fantastic either lit or unlit. Unlit, the panels are an emerald green, darker than the image. Thank you Michelle for stocking this!&lt;br /&gt;
&lt;br /&gt;
Blanka wanted something to celebrate returning from her &lt;a href="http://www.soul-coaching.com/" target="_blank"&gt;Soul Coaching&lt;/a&gt; seminar in California, and this was it!&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/Y3eyZXb-FKM" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/2404357403000961635/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=2404357403000961635" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2404357403000961635?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/2404357403000961635?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/Y3eyZXb-FKM/going-green.html" title="Going Green" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/05/going-green.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DEMCQHg8eip7ImA9WhVWE0U.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-4041415984207261445</id><published>2012-04-25T16:41:00.000-04:00</published><updated>2012-04-25T16:41:01.672-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-04-25T16:41:01.672-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="folding" /><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><category scheme="http://www.blogger.com/atom/ns#" term="beginnings" /><title>Hairpin RNA</title><content type="html">Another entry in the "is function arbitrary" series...&lt;br /&gt;
&lt;br /&gt;
One of the most commonplace motifs in RNA molecules is the hairpin. The basic idea is this: the 'primary' structure of a strand of RNA is the sequence of bases, GCAU. But function doesn't depend on the primary sequence. That sequence has to be folded up into three dimensions - the 'tertiary' structure. In between primary and tertiary, we have the secondary structure, which captures most of the bonding between nucleotides in a flat, 2D picture.&lt;br /&gt;
&lt;br /&gt;
An RNA hairpin's primary structure is like a palindrome, the beginning and end are mirrors of each other. For example:&lt;br /&gt;
&lt;br /&gt;
GUGCCACGAUUCAACGUGGCAC&lt;br /&gt;
&lt;br /&gt;
Looks like:&lt;br /&gt;
&lt;div class="separator" style="clear: both; text-align: center;"&gt;
&lt;a href="http://upload.wikimedia.org/wikipedia/commons/3/3f/Stem-loop.svg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"&gt;&lt;img border="0" height="219" src="http://upload.wikimedia.org/wikipedia/commons/3/3f/Stem-loop.svg" width="320" /&gt;&lt;/a&gt;&lt;/div&gt;
(Credit Wikipedia, article '&lt;a href="http://en.wikipedia.org/wiki/Hairpin_loop" target="_blank"&gt;Stem-Loop&lt;/a&gt;')&lt;br /&gt;
&lt;br /&gt;
It just isn't that hard for these things to form by chance. An example such as the above, with an 8 base pair stem, has a 1 in 64,000 chance of forming in a random chain. That might not sound like a lot to us humans, but to molecules where gazillions can be held in a drop of water, a lot hairpins can form! 1 in 64K is way way lower than William Dembski's Universal Probability Bound of 1 in 10^150, so even he would agree that no "Intelligent Designer" is necessary.&lt;br /&gt;
&lt;br /&gt;
So if 1 in 64K of short (11 base pair) primary sequences forms a hairpin secondary structure, how many of those show stability and biological function as a tertiary (3D) structure? A good question. "Function" can be based on the choice of the base pair at the bottom of the stem, the stem pairs, and the top. But it is clear that even small, simple molecules such as these can have significant function, as shown by the existence of ribozymes (enzymes made of RNA) such as the Hairpin or Hammerhead ribozyme.&lt;br /&gt;
&lt;br /&gt;
Further, really important molecules such as transfer RNA are simply 4 hairpins stuck together like Lego blocks. This structure can be broken down into the "top half", consisting of two of the hairpins, and the "bottom half", the other two. These halves could have &lt;a href="http://rna.cshl.edu/content/free/chapters/03_rna_world_2nd.pdf" target="_blank"&gt;evolved independently&lt;/a&gt; and then acquired new functionality when they stuck together.&lt;br /&gt;
&lt;br /&gt;
A key message of ID and pure creationist propaganda is that the system of replication used in cells today is too complex to have arisen without guidance by a Creator. Looking at the reality of RNA hairpins, we can see that this is not true. A key piece of our current replication machinery is cobbled together from smaller parts that could easily have formed by chance, and then been retained for their function.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/Dt0pCnAaAEY" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/4041415984207261445/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=4041415984207261445" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4041415984207261445?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/4041415984207261445?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/Dt0pCnAaAEY/hairpin-rna.html" title="Hairpin RNA" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/04/hairpin-rna.html</feedburner:origLink></entry><entry gd:etag="W/&quot;CEANQ3kyeip7ImA9WhVWE0U.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-5497419279219531260</id><published>2012-04-25T15:39:00.000-04:00</published><updated>2012-04-25T15:39:52.792-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-04-25T15:39:52.792-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><title>RNA vs. Jenga!</title><content type="html">I recently spent some time&amp;nbsp;talking&amp;nbsp;about binding affinities in molecules such as DNA, RNA, and proteins. I said previously that there wasn't any differential binding affinity from one base pair to the next.&lt;br /&gt;
&lt;br /&gt;
That turns out not to be the case. (aka FAIL) There _are_ base stacking interactions that can stabilize DNA and RNA molecules. These means that some sequences will be more likely than others in the real world.&lt;br /&gt;
&lt;br /&gt;
The situation can be explained with an analogy to human language. This is good, because Polanyi worshipers love this analogy. In English, Q is followed by U consistently. That is a complete affinity. We can also talk about an affinity between two classes of letters, those representing consonant sounds and those representing vowel sounds. A string of letters is more likely if it contains alternations between these two classes.&lt;br /&gt;
&lt;br /&gt;
Why is that? Well, in written English you'd be wrong to imagine that the choice of letter order was entirely arbitrary, it obviously isn't. (If it was, we wouldn't be able to compress English text very well, which is obviously not the case.) Written English derives from spoken English, and it is a lot easier to transition from one consonant to another through a vowel sound rather than directly. If you disagree, try the Czech phrase "Strč prst skrz krk" which translates roughly as "stick a finger in your throat".&lt;br /&gt;
&lt;br /&gt;
From here, we can see that Polanyi's analogy was a FAIL to begin with, since the thing he wanted to analogize to, human language, does show constraints based on physical properties of the world and is not an arbitrary symbol system.&lt;br /&gt;
&lt;br /&gt;
And Jenga!? Obviously, the choices you make in this block stacking game are not arbitrary, either. Every player knows that a stack built of "middle" bricks is going to be very unstable.&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/ORI0IdcZNX0" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/5497419279219531260/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=5497419279219531260" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5497419279219531260?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/5497419279219531260?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/ORI0IdcZNX0/rna-vs-jenga.html" title="RNA vs. Jenga!" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/04/rna-vs-jenga.html</feedburner:origLink></entry><entry gd:etag="W/&quot;C0cNQ3s8eyp7ImA9WhVXE0k.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-7617278485047675929</id><published>2012-04-13T14:18:00.000-04:00</published><updated>2012-04-13T14:18:12.573-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-04-13T14:18:12.573-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><title>No error bars, no science</title><content type="html">&lt;span style="background-color: white; color: #404040; font-family: Verdana, Helvetica, Arial, sans-serif; font-size: 13px; line-height: 16px; text-align: left;"&gt;There is a meme circulating in the skeptics of global warming blogosphere - "no error bars, no science" which is meant as a criticism of papers they disagree with. A laudable concern in general, but what is good for the goose is good for the gander.&amp;nbsp;&lt;/span&gt;&lt;br style="background-color: white; color: #404040; font-family: Verdana, Helvetica, Arial, sans-serif; font-size: 13px; line-height: 16px; margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; padding-bottom: 0px; padding-left: 0px; padding-right: 0px; padding-top: 0px; text-align: left;" /&gt;&lt;br style="background-color: white; color: #404040; font-family: Verdana, Helvetica, Arial, sans-serif; font-size: 13px; line-height: 16px; margin-bottom: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; padding-bottom: 0px; padding-left: 0px; padding-right: 0px; padding-top: 0px; text-align: left;" /&gt;&lt;span style="background-color: white; color: #404040; font-family: Verdana, Helvetica, Arial, sans-serif; font-size: 13px; line-height: 16px; text-align: left;"&gt;Apply the same idea to ID, friends. What is the error bar on "Goddidit"? If ID would like to be considered a scientific topic, what error bars will Dembski, et al. attach to their work?&lt;/span&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/cVmV1AJhXsM" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/7617278485047675929/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=7617278485047675929" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/7617278485047675929?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/7617278485047675929?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/cVmV1AJhXsM/no-error-bars-no-science.html" title="No error bars, no science" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/04/no-error-bars-no-science.html</feedburner:origLink></entry><entry gd:etag="W/&quot;DUcDR3w8eCp7ImA9WhVXE08.&quot;"><id>tag:blogger.com,1999:blog-14665490156141690.post-550366860663743179</id><published>2012-04-10T18:07:00.003-04:00</published><updated>2012-04-13T10:24:36.270-04:00</updated><app:edited xmlns:app="http://www.w3.org/2007/app">2012-04-13T10:24:36.270-04:00</app:edited><category scheme="http://www.blogger.com/atom/ns#" term="evolution" /><category scheme="http://www.blogger.com/atom/ns#" term="intelligent design" /><title>Moshe Averick Helps Meyer Hide the Afikoman of Understanding</title><content type="html">&lt;div dir="ltr"&gt;&lt;style&gt;
&lt;!-- .hmmessage P { margin:0px; padding:0px } body.hmmessage { font-size: 10pt; font-family:Tahoma } --&gt;
&lt;/style&gt; &lt;br /&gt;
&lt;div dir="ltr"&gt;Signature in the Cell, Stephen Meyer's gift that keeps on giving. Published in 2009, this book stirred up some controversy at the time over its review of Origin Of Life (OOL) theories and crowning of ID as the "best explanation".&lt;br /&gt;
&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Recently, the book was &lt;a href="http://robertsaunders.org.uk/wordpress/2012/03/13/no-signature-in-the-cell/" target="_blank"&gt;reviewed by British geneticist Richard Saunders on his blog, Wonderful Life&lt;/a&gt;. This review attracted the attention of the Discovery Institute and one of the DI's pilot fish, Moshe Averick. &lt;a href="http://www.algemeiner.com/2012/04/04/british-geneticist-robert-saunders-leaves-a-highly-prejudiced-signature-in-his-review-of-signature-in-the-cell/" target="_blank"&gt;Averick wrote a scolding rejoinder to Saunders&lt;/a&gt;, earning him a &lt;a href="http://www.evolutionnews.org/2012/04/on_signature_in058211.html" target="_blank"&gt;pat on the head from David Klinghoffer&lt;/a&gt; over on Evolution News and Views.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;(An aside. Averick deserves some respect, not for the validity of his opinions or his choice of culture war bedmates, but for having the guts to write in a forum that accepts comments. Most of the DI propaganda machine operates in the criticism free zone of their own web sites, no comments allowed. The same tip of the hat goes to Cornelius Hunter, the Baghdad Bob of anti-Darwinian creationists. Hunter's agit-prop is completely disengaged from the stated moral code of his religion, but he does allow comments to his blog!)&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;I'm not going to try to fisk Averick's piece, it doesn't deserve that much attention. I am going to focus on the issue of Meyer's discussion of differential binding affinities, since it was one of the points about Saunder's review that Averick jumped on.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Wow, "differential binding affinities"... I can hear your eyes glazing over already. Half my readership just left to check their Facebook pages, and there was only two of you in the first place!&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Yes friend, "differential binding affinities" is actually one of those important places in Signature in the Cell where Meyer connects his philosophy to real world science, showing the roots of the Intelligent Design movement.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Stepping back for a moment, one of the big ID arguments is that everything has to be explained by one of three drivers, chance, necessity, or Design. If we can eliminate chance and necessity, we are forced to choose Design as the best explanation.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;So what are differential binding affinities? We know that DNA uses a four letter alphabet, ACGT. In a real DNA molecule, A and T pair up, as do C and G. These pairs are on the inside of the famous double helix shape. They are the rungs of the twisting ladder. The outside of the helix, where each pair is connected to the next pair, is made of phosphate molecules.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;If I told you that one 'rung' of the helix was A-T, could you predict the next rung? Not really. There are four possibilities (A-T, T-A, C-G, and G-C) and they are all equally probable. That is the opposite of a differential affinity. In a differential affinity, A-T might be followed 50% the time by T-A, and never by G-C.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Meyer connects this idea to two different strands of thought. One is the idea that either the proteins or DNA sequences of life exist by necessity - because there is no other way to make the pieces fit together. Meyer attributes this idea to Dean Kenyon as an early (1980s) OOL explanation. My research can't confirm whether this idea actually had any followers.&amp;nbsp;&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;I admit that I am a bit suspicious since Kenyon, now a creationist, works with Stephen Meyer at the Discovery Institute. Bringing in Kenyon's work gives Meyer a strawman to knock down and an opportunity to play the sympathy card for Kenyon, who faced some strong criticism for mixing in creationism in his evolution courses.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;The other connection is with the philosophy of Michael Polanyi. Polanyi was a well respected chemist and philosopher of science, but apparently had a thing about evolution. He wrote an essay, "Life's Irreducible Structure", that is very influential to the ID movement. It is to this essay that Meyer links the binding affinities issue, since to him it affirms the position of Polanyi that information is not reducible to structure, the "physico-chemical" laws of the universe.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;This is (finally!) the important point of this section of Meyer's book. It is important to Meyer, and that is why it gets the "revelation from on high" treatment that Saunders objects to in his review, mentioned above.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;&lt;span style="font-size: large;"&gt;&lt;b&gt;Sorry, your afikoman is in another castle!&lt;/b&gt;&lt;/span&gt;&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Since Averick is not shy about his rabbinic degree, I'll use a timely Jewish analogy. During the Passover seder, the leader hides the afikoman, a piece of matzah that will be used to complete the rituals later in the evening. Meyer (not Jewish, BTW) is also hiding something, and Averick is only too happy to help him do it. What is that something?&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Meyer's book is about the origin of the genetic code. That is the "signature in the cell". The genetic code maps triplets of RNA nucleotides (AGC, for example) to the 20 or so amino acids that are used to build proteins. But Meyer is hiding something about nucleotide triplets and amino acids, and if you guessed "differential binding affinities" you win!&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Here's the basic idea. Make some long repeating strands of RNA, such as ACTACTACT... . Now stir in different amino acids. In water, all the RNA and amino acid molecules will be in constant motion, bumping into each other in various ways. Sometimes they might stick briefly to each other before the water molecules push them apart. That length of time is their biding affinity and it is not the same for all combinations. Some combinations of triplet and amino acid are much more likely to stick together than others.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;What does this mean? Say we had a little OOL scenario, warm pond, all the amino acids floating around and some short random RNA sequences as well. One of those RNAs is AUGGCC, for example. The AUG will prefer to stick to the amino acid Methionone, while the GCC will prefer to stick to Alanine. At some point, both a Methionone and an Alanine are sticking to this little RNA long enough for them to link together spontaneously. Now instead of two amino acids we have one small protein.&amp;nbsp;&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;The point here is that the differential stickiness of RNA and amino acids did not have to be "Designed". It is inherent in the physics and chemistry of the world. Polanyi was wrong. The genetic code was not "Designed", it flows naturally from these differential binding affinities.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;What I've sketched out in the preceding paragraphs is called the "stereochemical hypothesis", and is an active research topic for OOL scientists such as Michael Yarus. (It is active because more evidence keeps accumulating that it is correct.) Meyer claims to be giving a thorough survey of all OOL work in his book, as a matter of fact his argument _requires_ him to survey all possible options and find them inadequate before he can conclude that Design is the best explanation. But just like the seder leader hiding the afikoman, Meyer has hidden any discussion of the stereochemical hypothesis (and most of the rest of the modern research on the RNA World) from view in his book.&lt;/div&gt;&lt;div&gt;&lt;br /&gt;
&lt;/div&gt;&lt;div&gt;Averick, the cheerleader and pilot fish, is only too happy to help do the hiding. He doesn't know the stereochemical hypothesis from a hole in the wall, but if Meyer is going to pound on about no differential binding affinities in DNA, Averick is there pounding also.&lt;/div&gt;&lt;/div&gt;&lt;/div&gt;&lt;img src="http://feeds.feedburner.com/~r/blogspot/gfWNB/~4/rMViwbuqP9Q" height="1" width="1"/&gt;</content><link rel="replies" type="application/atom+xml" href="http://dvunkannon.blogspot.com/feeds/550366860663743179/comments/default" title="Post Comments" /><link rel="replies" type="text/html" href="http://www.blogger.com/comment.g?blogID=14665490156141690&amp;postID=550366860663743179" title="0 Comments" /><link rel="edit" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/550366860663743179?v=2" /><link rel="self" type="application/atom+xml" href="http://www.blogger.com/feeds/14665490156141690/posts/default/550366860663743179?v=2" /><link rel="alternate" type="text/html" href="http://feedproxy.google.com/~r/blogspot/gfWNB/~3/rMViwbuqP9Q/moshe-averick-helps-meyer-hide-afikoman.html" title="Moshe Averick Helps Meyer Hide the Afikoman of Understanding" /><author><name>David vun Kannon</name><uri>https://plus.google.com/102059966082653977223</uri><email>noreply@blogger.com</email><gd:image rel="http://schemas.google.com/g/2005#thumbnail" width="32" height="32" src="//lh3.googleusercontent.com/-TJeb25IYD4I/AAAAAAAAAAI/AAAAAAAAAD4/m6_wsWT2YFw/s512-c/photo.jpg" /></author><thr:total>0</thr:total><feedburner:origLink>http://dvunkannon.blogspot.com/2012/04/moshe-averick-helps-meyer-hide-afikoman.html</feedburner:origLink></entry></feed>
