Palecomic

Not really a post at all

noreply@blogger.com (Mike) — Sat, 22 Aug 2009 04:53:00 +0000

Just this:

Beast - Mr. Hurricane from MapleMusic Recordings on Vimeo.

Transformations

noreply@blogger.com (Mike) — Sat, 08 Aug 2009 17:52:00 +0000

I haven't updated about the ants in ages, and you deserve to know how they're doing. Prepare yourself for some changes.

You may remember that I was concerned that they were bored (which sounds ridiculous, perhaps I'm no better than the kid with the perpetually runny nose, a stick and a nasty streak on a day at the zoo) and so decided to add some grass seed for them to gather up. I didn't manage to get my hands on a sensible quantity of grass seed so I figured that sesame seeds would substitute. The ants showed some interest and a few made it to the bottom of the tunnels and got tucked away, the remainder were left where they fell. Maybe they're picky and sesame seeds just don't cut the mustard, maybe when they're burrowing through a delicious, sugary gel they don't really need to be bothered with my paltry offering.

However, I wasn't just sowing seeds; along with them came an inoculum of fungi that liked the gel just as much as the ants.

And a fly-by (caution, my videography isn't for the car sick).

Not the nice, space-age blue gel I started out with. The ants didn't mind this at all, in fact they would pull off chunks of the blackened gel and carry it up to the surface of the tunnels to a pile that I started to view as a sort of midden. They would eat the fungus sprouting from individual sesame seeds and add these to the pile on the surface too. Eventually, when the mould became extensive they would feed happily on this large pile of dense, ant-farmed matter.

At any one time there was still a division of labour, with some ants on the surface browsing around and nibbling and the remainder down in the tunnels. Here's Humdiggler napping:

That's change number one, now for change number two and it's a sad one. I can only count eleven ants. Twenty-five went in, one suffered from a bad case of nominative determinism (any pet I have from now on is going to be called Methuselah) and the remaining unlucky thirteen...? I suspect they've gone to the great network of tunnels in the sky. In fact, I managed to catch Minus - Warrior Queen of the Ant People carrying the corpse of Adam and trying to give her a head start on the journey.

It's not unexpected, I've had them for five months now and they're supposed to live between three and six months, but so long Nigella, Splodey, Carlotta, Gertrude, Antoinette, Flip, Tweetspawn, Sickof, Cuddles, Omar and Squash D. Say hi to Squish D for me.

Jobs

noreply@blogger.com (Mike) — Mon, 03 Aug 2009 17:57:00 +0000

Our group at UCSF is moving from Anesthesia to the Gastro-intestinal division (hooray, windows in the lab! Shiny benches!) and we're also expanding. Sue's advertising for three more postdocs (there are currently two of us in the group that also includes graduate students and clinical fellows) all in the general area of applying high throughput and molecular microbial ecology techniques to the human microbiome. Here's the announcement:

Postdoctoral Fellowships in Human Microbial Ecology and Culture-independent Diagnostic Development

Job Description: Three postdoctoral positions are available in the Department of Medicine, Division of Gastroenterology at the University of California San Francisco in the laboratory of Dr. Susan Lynch (Lynch Lab http://trmp.ucsf.edu/.

1. The first position will focus on the application of culture-independent approaches to determine the phylogenetic diversity and functional profile of microbial populations in clinical samples obtained from pediatric patients with irritable bowel disease.

2. The second will be primarily concerned with development and validation of a culture-independent diagnostic for rapid detection and antibiotic resistance profiling of a number of pathogenic species.

3. The third postdoctoral fellow will examine the airway microbiota of HIV-infected patients and the effect of treatment and disease progression on the phylogenetic diversity and functional repertoire of these microbial populations.

Individuals will be expected to design, with guidance from Dr. Lynch, and conduct experiments to interrogate the community and population ecology of microbes. They are also expected to publish research results and to engage in productive collaborations with other scientists at UCSF and other institutions involved in this project.

Minimum Requirements: Candidates must have received a PhD in microbiology or a closely related discipline within the past five years from an accredited college or university.

Qualifications: Technical expertise in both the application of molecular techniques in microbial ecology and basic microbial cultivation techniques is essential. Experience with culture-independent metagenomic or metatranscriptomic approaches, necessary statistical analyses tools, processing clinical samples and cellular level microbial physiology are highly desirable. The successful candidate will have strong written and oral communication skills and a proven track record in scientific publication.

These studies represent components of multidisciplinary efforts to investigate the host microbiome and examine antibiotic resistance evolution in bacterial communities; thus the ability to function collaboratively in multidisciplinary teams within UCSF and with external collaborators is important.

Salary is commensurate with experience. Please email curriculum vitae and names of three references to Dr. Susan Lynch (susan.lynch {at} ucsf.edu) before September 30th, 2009.

Equal Employment Opportunity: University of California San Francisco is an Affirmative Action / Equal Opportunity Employer and supports diversity in the workplace. Applicants will be considered for employment without regard to race, color, religion, sex, national origin, age, disability, veteran status, marital status, or sexual orientation. Women and members of minority groups are encouraged to apply.

We've got lots of things really moving forward and I think it's an excellent time to be joining the group. Plus I'm utterly charming - how can you lose?

You take the high shelf, and I'll take the low shelf...

noreply@blogger.com (Mike) — Sat, 18 Jul 2009 05:03:00 +0000

Earlier in the week, I noticed that the alternative reality gamers I follow on Twitter, apart from getting over-excited about this weekend's ARGfest-o-con, were mentioning something called Frenzied Waters, a promotion for the upcoming Shark Week on the Discovery Channel. The Frenzied Waters website is slightly sinister and seems to be documenting a number of shark attacks, the first two of which (Asbury Park, 1916 and Coral Sea, 1942) have short, shark-lunch eye view videos. My favourite part of the site is the Facebook link up where you find your profile plundered for photos that drift into the depths along with your luckless corpse and newspaper articles asking for, in my case, new postdoctoral researchers at UCSF.

In addition, as a new shark attack video is released each week, so too are 11 sets of coordinates that correspond to 11 capsules around the US, in various cities for people to claim. The San Francisco coordinates for the second week (Coral Sea) lead here:

View Larger Map

826 Valencia is a pretty well known address locally as it is the site of the Pirate Shop, set up by Dave Eggers of McSweeney's fame, and the best place in San Francisco to buy eye-patches and Jolly Rogers. The perfect place for hiding shark memorabilia! I made an early attempt to find the capsule on Wednesday, but just sort of whiffled about, making no headway with the staff who denied all knowledge of sharks, hidden capsules and gave me the special blank looks usually reserved for those times when I try and order water to drink ('Can I have a water', 'What?', 'Waaaa-durrr?', 'What?!', 'Gin and tonic please').

By Friday, the SF capsule was the only one left to collect, determined that it would be mine I took back up: Yvonne for her wheels (and good eye it turns out) and Kei in case we needed biological weaponry (she's recovering from something she denies is swine flu). Yvonne spotted the capsule, an opaque glass jar, within moments of arriving, on a very high shelf (I was squatting in another corner looking in completely the wrong place) and I negotiated with the unceasingly playful, beardy-weirdy staff (different one today), for access to it.

Here's the triumphant (if diminutive) team with the capsule (and spiky plant from the shop next door, which also happens to sell fox penis bones. I kid you not):

Here's the aformentioned beardy-weirdy (this is an affectionate term from one poorly groomed individual to another, besides, he attacked me with mop heads using a nefarious contraption suspended from the ceiling):

And here's what it contained:

One seal on the lid.

One chunk of rubber life jacket.

One water (hopefully) stained hat.

One postcard from Sidney showing the Botanical Gardens and dated 20th April 1942.

One small, water-proof capsule containing waxed matches, and a photograph of a woman, with "With you wherever you are" written on the back.

One photo of a woman who is attempting to look saucy despite enormous floral (woollen?) bathing costume.

Finally, (and a personal favourite) one large shark's tooth attached to a copper tag and stamped with a not active (yet) url.

Can any marine biologists out there identify what type of shark that tooth is actually from? It's about 6 cm long by 4.5 wide. Looking forward to trying to find next week's capsule, and to what's at the end of that url! Follow @frenziedwaters on twitter or search twitter for #frenziedwaters to keep up to date.

[EDIT]

I'm pretty sure it's the tooth of an Oceanic Whitetip. They're the same genus as Great Whites and the teeth are supposed to look similar, but the serrations on a Great White's tooth are less even. Oceanic Whitetips don't flirt with the press as much as Great White's, but are responsible for more human fatalities than all other shark species combined.

Into the Lovely Garden

noreply@blogger.com (Mike) — Sun, 24 May 2009 15:53:00 +0000

Conferences are hell, and big conferences are heller, but this one was pretty good. I've just got back from the American Society for Microbiology's 109th General Meeting. It covered all the various flavours of microbiology with hundreds of talks and thousands of posters (ours are available here in case you're interested in what we're up to).

It's too big, they're always too big and you can't see everything that you want to see because things clash or are in meeting rooms so far flung that you miss the beginnings and ends in the trek between. The real trick is to go and see talks that you know nothing about, there will always be more specific meetings in your own field that will be useful for keeping up to date with that, but I tried to liberally sprinkle the talks I was aiming for with random things.

Among my favourites were one on farts from Glen Gibson at Reading University, about gas generation (particularly hydrogen sulfide) by gut bacteria and how this can effect various states of health and how it can be manipulated using prebiotics. I also liked Jessica Green's talk (who looks nothing like she does in that photo, but I'm fairly sure she's the right Jessica Green); she's a hardcore computational ecologist and unlike most of those guys who seem to like counting big fluffy animals or fish, she's attempting to formulate ecological theories that also successfully encompass the main domains of life (I'm not biased), the bacteria and archaea as well. I have to confess that she lost me a bit with her quantum field theory, but it was fascinating nonetheless. Also, her Science paper begins with a Lewis Carroll quote:

And so it was indeed: she was now only ten inches high, andher face brightened up at the thought that she was now the rightsize for going though the little door into that lovely garden.

so she wins extra points for that too.

One of the themes running through the meeting was the use of high throughput sequencing data; how to use it, what it's good for, what it isn't good for, problems and comparability. The US bit of the Human Microbiome Project for example, which aims to sequence the bacteria associated with our bodies (90% of the cells in your body aren't human, they're bacterial or archaeal), have generated vast amounts of sequence data already (tens of gigabases), using different sequencing methodologies. Analysing that data is going to be a massive task. I have to confess I missed the session called "the $1 genome" which looked great. Instead we skipped off for a daytrip to New York, booked before I'd seen the schedule. Nevermind, my brain was too full by then anyway.

Open access science was represented by a round table discussion, with live stream and twitter comments and questions from the ustream viewers. The discussion is still available at ustream, and the first section of five is below.

I only caught the last half due to a clash with other talks, but it seemed to be going well. I particularly enjoyed the glee in the convener's voice whenever they got a question from Twitter. Jonathan Eisen, and Chris Condayan were heavily involved in those sessions and are also Open access advocates if you're interested in following them and Rosie Redfield was also there, she runs a completely open lab and her blog is also her lab book. You can see what she's currently working on here.

Ruth Ley and Rob Knight (genius) gave typically amazing talks about microbial ecology, and specifically gut bacteria. Transplanting gut bacterial populations from fat mice to thin mice makes the thin mice fat, even when they are on exactly the same diet and the bacteria in your gut are more highly specialised than those living in any other extreme niche (hydrothermal vents, arctic environments etc.). Rob Knight manages to find ways of analysing microbial population data that are incredibly insightful. I want to borrow his brain, just for a bit, and make a copy.

I'd love to be able to link to the talks, or the posters from various people, but the ASM is a little but recalcitrant about things like that. You can't record your own presentation for example (they're trying to make money out of selling them) and photos were banned in the poster hall. A bit of shame when you consider the amount of work that goes into the presentations and posters that they're not actually useful beyond the four walls of the meeting. Still, we've circumvented that by making our posters available to look at and download - let me know if you have any questions about any of the work, and the ASM, particularly via MicrobeWorld is making great efforts in communicating science more widely.

It's a Viola

noreply@blogger.com (Mike) — Mon, 20 Apr 2009 16:44:00 +0000

On Saturday, which we had planned to be a day of boring old "sorting out" ready for our visitors from across the sea, @magic_walnut let us know that he was buying tickets for Noah & the Whale that night. The three of us are good at adventures, and his girlfriend's brother Jason was coming along too. It was at The Independent and very quiet (which is always nice as Bluessinger's not a fan of crowds at gigs); if you're going The Madrone is close and good for a drink beforehand (and not as pretentious as the website seems).

Noah & the Whale were good. Much better and less twee than the single, which I liked, but played to death (27 plays according to Last.fm). They were supported by Ferraby Lionheart, who was good when he did the faster, folky stuff and minor torture with the slow, introspective, poetry-with-a-piano, whingey stuff.

The best bit for me though was Anni Rossi. She started the evening, slightly nervously when half the crowd had yet to arrive, and she was great. She plays a viola, whilst beating her own percussion by standing and stomping on the viola case and singing. She reminds me a bit of Regina Spektor (if she was Scandinavian), or maybe Bat for Lashes, but grown up and no longer raiding the dressing up box. I've been trying to find a video or version of one of her tracks that does her justice, but they don't really. She's much better live. Which doesn't help you at all, but she's playing gigs all over so you might be able to catch her.

Anyway try and imagine the following, a little faster, more impassioned and with stomping. Look out for covers of Ace of Base's Living in Danger and Radiohead's Creep too.

Stains that are suspect...

noreply@blogger.com (Mike) — Mon, 20 Apr 2009 16:28:00 +0000

I was recently reminded of this piece of genius from 1998. The All Seeing I, Jarvis Cocker and Tony Christie encapsulated in one excellent video.

I'm off to walk the aisles of Safeway like a panther.

Smattering

noreply@blogger.com (Mike) — Thu, 02 Apr 2009 03:05:00 +0000

That's a funny word isn't it? It looks very odd on its own. It is apt for this post though:

The Penguin Blog produces one of the most stylish blog posts I've ever seen here.

Roo Reynolds of the BBC (who has one of the most extraordinary job titles I've come across) gets caught in the G20 protests and captures the situation well.

@rotek (also known as Shane of O:SC) drew my attention to Omegle which connects you to one-to-one chats with a complete stranger (probably). I've tried it once and had the following conversation:

You: Hello!
Stranger: god?
Stranger: is that you?
You: Yep - here I am
You: what seems to be the problem
You: ?
Stranger: wonderful, can I confess my sins to you
You: I know them already
You: That thing with the hamster was a bit weird, but it takes all sorts
Stranger: Gayto and Kane got nasty with each other and I seen it and now I feel really dirty.
You: Oops, got a call on another line - gotta go

As you see, I got out of there just in time. There was a short pause between "is that you?" and "Yep - here I am" as I decided to play along. That was probably my first mistake. Still, nothing ventured, nothing gained.

I can't stop playing the following song repeatedly:

Finally, tomorrow Operation Sprinkle goes into action. I'm going to add some sesame seeds (they don't sell grass seed in Whole Foods) to the ants and see what they make of it.

Ennui

noreply@blogger.com (Mike) — Fri, 27 Mar 2009 17:49:00 +0000

The recent level of activity in the Queendom of the ants is best measured by the number of taps on the glass from my regular visitors and their whinges of "why aren't they doing anything?". Since the last post they have managed three little tunnels, creating a ladder in the centre and a swooping, weedy thing on the right-hand side.

Most of the group have started a love-in at the far left corner, where they nibble the agar and nuzzle each other.

Occasionally the more adventurous among them (Boothby Graffoe, Gertrude and Adam come to mind) wander off to attempt to scale the walls or chew pointlessly at the floor.

In this state of boredom, Antoinette has gone bananas and is dementedly chewing the rubber seal off from the inside. It's really tough stuff and quite hard to remove with a fingernail - her insanity must lend her super-formican strength. She's actually balancing on one leg to do it.

I have had suggestions of things to do to stimulate them (and am protecting them as best I can from the glass tappers, with my trademark self-righteous indignation) which have included cockroach vs ants deathmatch and making casts of the tunnels with molten lead. These I have dismissed with a raised eyebrow (the right eyebrow, the other one doesn't move independently) and I'm trying to find somewhere to buy grass-seed in less than entire lawn quantities so that the Harvesters actually have something to harvest. That should keep them amused, perhaps enough so that they'll stop their unseemly, day-long fondling. Any additional suggestions, please comment below, Tally's getting tired of Tweetspawn's attention.

And now for something completely...similar.

noreply@blogger.com (Mike) — Tue, 17 Mar 2009 03:23:00 +0000

When did I become an Antblogger? A Myrmepistolarist? A Formicadiarist? Oh well, won't be for much longer given the events of today.

But that's me dwelling in self-pity, here we go with news of the 24.

There have been massive weekend excavations, mostly vertically, around the walls and underneath. There are one or two connecting tunnels, but these are straight up and down, no nonsense, let's-see-where-this-one-comes-out ladies.

Today I saw Carlotta poo, though failed to catch it on film. It involved quite a lot of stillness and contemplation on her part, then a subtle brown staining of a little agar block. Very civilised.

The winning name for the final ant with no name (I'd have called her Sin Nombre after my favourite virus - there's poetry in that name) is MonsterDong. There had to be one with a rude name, thanks Rich. Not sure about the spacing and capitalisation, it makes her sound a little like a brand, but nevertheless there she is.

Finally, I managed to catch them at the beginning, middle and end of a tunnel this afternoon.

Dig my pretties!

You may notice that I've done something bad and purloined music from my collection. I will of course remove, distroy and disable on request (and beg on my knees for forgiveness) - but the tracks concerned are from Johnny Flynn's fantastic album A Larum (Fabulist have a post with him singing with Laura Marling - it's lovely), Yann Tiersen's wonderful Amelie soundtrack, and Kyle Gabler's soundtrack to The World of Goo (one of the best game soundtracks I've ever heard), which he is giving away free here. I should also acknowledge the shadows of Liel and Nicole, which is why this sometimes turns green. They like ants.

This is why I'm not allowed pets...

noreply@blogger.com (Mike) — Tue, 17 Mar 2009 02:48:00 +0000

Some caveats:

We spent a stereotypical sleepless weekend in Seattle
I've got too much to do
My left frontal sinus decided to explode during the descent as we came back into San Francisco and I'm on a cocktail of decongestants, antibiotics, painkillers and steroids that makes me feel a little odd

None of which really excuses the bad news (which I shall start with). Make sure you're sitting down it's a shocker. Squish D, in a tragic case of nominative determinism, got squashed.

The ants had been incredibly busy over the weekend, there are multiple new tunnels which are mainly vertical, but there are complicated interconnections around the edges and the rubble that's been removed has been carefully added to the top to make another area for digging. This means that the distance between the ants and the lid has been decreased, to the extent that Marduk T-shirt Men's Room Incident spends most of her time chewing on the rubber seal.

Once a week you're supposed to let a bit of air into the habitat, there are little airholes in the top (just the two, about large enough to slip the end of a paper-clip into) but I decided to open it a crack to get a proper influx of fresh air. About five of the industrious ladies were waving at the lid and I tapped them down beforehand. Levering up the lid, I failed to notice Squish D clinging to the underside and as I immediately replaced it she became trapped (avert your eyes for a grisly detail) with a sickening crunch between the seal and the walls. RIP Squish D. Actually RIBB (Rest in Biohazard Bin).

As if I didn't feel guilty enough, the rest of the colony became avenging Valkyries, and swarmed to the precise area, wondering where Squish D could have gone to and vowing vengeance on her thick-fingered, idiot nemesis (below).

I feel a bit overcome. I'll leave the good news for a separate post and leave this one to the memory of the short-lived Squish D. She was personally responsible for renewing the interest in Keith's tunnel and her star shone so brightly before its tragic quenching between two pieces of perspex. So long, farewell, auf wiedersehn, goodbye.

PS

If this nominative determinism thing holds true, I'm quite concerned for Splodey.

Day Two: 20 Feet Short

noreply@blogger.com (Mike) — Fri, 13 Mar 2009 04:17:00 +0000

They weren't supposed to start tunneling for 24-48 hours, but about 16 hours later, they've excavated one entire side of the blue-agar stuff down to the bottom and created a U-shaped tube back to the surface. The excised chunks of agar have been distributed across most of the surface, but particularly at the sides, building climbing walls up the perspex. I put the early tunneling start down to the fact that my ants are special, early developers. They're better than other people's ants. Oh yes. That and the lab is boiling hot at the moment as the air conditioning's gone again so they're a lot more active.

I say most of the surface for the bricks, that's because they've left a clear patch near the exit of the tunnel where they gather for rest breaks when they're not on digging duty. The agar acts both as food stuff and tunneling substrate and during the rests they nibble at it slightly and seem to be supping. They aren't eating the big chunks that they break off.

You can see the entrance to the hole from above just south of Bertwhistle's derriere in the above shot. You can also see that they have little concept of personal space, a little like passengers on the Number 30 bus in SF (see here for number 30 adventures), and that Splodey seems to be grooming Flip whilst Tweetspawn does Boothby Graffoe. I've a feeling Tally's under there somewhere too. Between a third and two thirds of them seem to be resting at any one time with quite regular change overs.

After lunch, they aborted a second tunneling project that was starting in the opposite corner, leaving Keith dejectedly licking condensation off the wall:

And instead they plumped for a new tunnel (under the direction of Margot) starting alongside the first - I've not perfected the transfer of video from camera to web yet, and I've lost a lot of resolution going via iphoto, imovie 08 (clunky) and finally to youtube, I'll see if I can improve on the below, but here they are, hard at work. And so am I in the background. I must stop biting my nails.

Aaargh! Youtube's down for maintenance. OK - let's try this another way.

It's like ant therapy to watch them - and I should probably start charging given the number of visitors I'm attracting! You can watch them remove the blocks in two directions, up the left hand side and out of view, or up the u-shaped tunnel on the other side of the agar. More on Monday as away for a short while, all I hope is that they don't die over the weekend!

Introducing

noreply@blogger.com (Mike) — Wed, 11 Mar 2009 18:17:00 +0000

To express how giddy with excitement I am. My Harvester Ants arrived in the post this morning in a little tube (arty out of focus shot below). I think they're Red Harvesters (Pogonomyrmex barbatus) and they're brilliant.

They apparently bite and sting, so in order to transfer them I popped them in the fridge for 10 minutes to cool them down. At which point they were lethargic enough to get into their gel-matrix habitat - the moment of transfer below.

Sadly, four of the little fellas, pardon me, ladies were dead on arrival, but there are still 25 of their nestmates nibbling at the surace of the matrix, freshening up after their postage. Introducing: Yolanda, Madlenka, Nigella, Margot, Splodey, Carlotta, Oswald, Tally, Minus - Warrior Queen of the Ant People, Marduk T-shirt Men's Room Incdient, Antoinette, Flip, Humdiggler, Boothby Graffoe, Tweetspawn, Sickof, Keith, Bertwhistle, Gertrude, Adam, Cuddles, Squash D, Squish D and Omar. Except for Yolanda and Nigella, who are collaborating on escape plans.

You can expect detailed updates, and if I manage it, maybe even live video. Oh yes. You may have noticed that there are only 24 names there. Leave your suggestions in comments and I'll pick a favourite for the final ant. I love this. I'm thrilled!

I Loves a Challenge

noreply@blogger.com (Mike) — Sat, 07 Mar 2009 18:31:00 +0000

I just received an email update about Routes from Matt Blacker- apparently a new page of DNA has been uploaded to the case file by the Police in Calca. Using the same method as before I've just translated it and here's what I got:

N E E D I D E N T I T Y G F E K P L G R E R F I G P R E Stop T I M I N G S S T I L L I N Q P E S T I G N Stop D I S E A S E S P R E A D I N Q P E S T I G N Stop P R G G F V I A H G S P I T A L R E Q P I R E S C A S E A N D P G L I C E C G G P E R A T I G N Stop

Need identity of Ekulorer figure
Timings still in question
Disease spread in question
Proof via hospital requires case and police cooperation

P has been substituted for U and G for O as neither of these two letters are in the Protein sequence. The critical part that I've completely mangled is "need identity of Ekulorer figure". Nonsense. But of course, P occasionally also needs to be P, and not always U, so we have "Ekplorer figure", or even better, because K looks like an X as much as G looks like an O: "Explorer figure".

Taking that new info back to the original code we got last week it clears things up a little bit.

S T G R Y N E E D S L E G A L C L E A R A N C E Stop P R I E S G L I C I T G X L D N

Story needs legal clearance
Urie Solicito(r) LDN

It's the story (the one that Schoenberg had for Matt) that needs legal clearance, not a stingray after all. There's me hoping for submarines and Aqua Marina. Perhaps Schoenberg had already contacted the solicitor in London (that's how I'm interpreting the second sentence) and he has more information on, or even a copy of the story? According to the updated code he's called Urie. Hmm. Urie? Prie? I'm not quite satisfied with that bit.

So what's going on? I think a couple of things need to be done:

1. Identify the explorer figure
2. Get the case from the hospital concerning the disease mentioned (that sounds worrying)
3. Contact this solicitor Urie (depending on how much you trust my translation) and try and find out what the story was.

Though I'm going to take time for a moments reflection below. She's irrelavent to this post, but lovely. And she's got her own theme tune.

Routes Update

noreply@blogger.com (Mike) — Fri, 20 Feb 2009 03:13:00 +0000

Of interest to those of you following the Channel 4/Wellcome Trust game at www.routesgame.com, not only is there a documentary to follow and flash games to play (and playstations to be won), but there is also an ARG lurking in the background. See the Unforum thread, the catch up videos and Matt Blacker and Rachel Bickles' blogs (they're a rookie journalist and professional niece respectively, investigating Markus Schoenberg's mysterious death in Peru. Yes, Peru) to find out what's going on. The catch up videos should be enough if you just want to dip in to it.

In my last post I described how I stumbled across (all on my ownsome) a way to access the police files on Schoenberg's death. Some people (hi Zoe!) have had problems accessing the images so I've uploaded them to flickr here in no particular order.

In doing so three images in particular caught my eye, partly becuase they're notes written in the same type of moleskine pad that I have (the squared one - love it) and partly because I spotted some familiar bits and pieces.

On one there is one (or a couple of?) DNA sequences

The sequences as two strings are:

TCGACGGGGCGTTATAATGAAGAGGATTCTTTGGAAGGCGCGCTATGTCTTGAGGCTAGAGCGAACTGTGAGTGA
CCTCGTATCGAATCCGGGCTTATATGTATCACCGGGARRTTGGACAACTGA

The first thing I'm tempted to do with a DNA sequence is to see what it is - I BLASTed it (a biological search algorithm) against the public sequence databases at the NCBI and got nothing. The second thing that I was tempted to do was to translate the DNA sequence into a protein sequence, each three letters in the DNA sequence represent one amino acid and there is a letter code used to represent each amino acid. You can do this for yourself here at ExPASy, copy and paste the sequence above and hit translate. You get six protein sequences back because with DNA sequences you can't always be sure whether the codons start at the first, second or third letter of the sequence and you don't know whether you should be reading forwards or backwards. For a table to do the same thing manually check out wikipedia here.

Anyway - this one's easy, it's forwards and the first DNA letter (I'm going to start calling them bases because it feels patronising calling them letters) is the start of the codon:

S T G R Y N E E D S L E G A L C L E A R A N C E Stop P R I E S G L I C I T G X L D N Stop

Certain things leap out: Stgry Needs Legal Clearance - Stingray needs legal clearance perhaps (because I like supermarionation); the two sentences are both ended by stop codons (TGA - oh yes, your DNA sequence even has punctuation) which is nice; and the second sentence makes less sense.

I thought that it might be in a different frame (the codons starting on the second or third base) but when you look at the other possible translations they make less sense (no nice neat stop codon at the end). I'm also intrigued by the X. X doesn't represent a particular amino acid and it's in there because ExPASy couldn't translate the codon ARR, which is fair enough because R isn't in DNA, it's an IUPAC ambiguity code - a fancy arsed way of saying "we're not sure whether this is an A or a G, but it's definitely one or the other". So ARR could be AAG, AGA, AAA or AGG, tranlsating that to protein there are only two options, L or K. Neither make any more sense. LDN at the end suggests London to me, but in what context? There are 323 anagrams of P R I E S G L I C I T G X L D N, none of which leap at me. I have a feeling there is more decrypting to be done to that part of the message, but I haven't got it yet. Tish.

Still, it's a start and Markus is egging us on - one of the notes on another page is "*idea* messages within life". The same page also references Craig Venter (coincidentally, I've blogged about him before) - I have a feeling that he's mentioned in order to reference his work on synthetic biology, building organisms (specifically bacteria in the first instance) from scratch for particular purposes, such as fuel production.

Crime scene, mug shots and translations

noreply@blogger.com (Mike) — Sun, 15 Feb 2009 19:54:00 +0000

I'm good - so very good at cracking passwords. But only when they're the name of someone's son. The investigation into the death of Routes adviser Markus Schoenberg is hotting up - and we can now see the case files for the Calca Police investigation by putting in the the case file number: CLC0108-1314, investigating officer's name: cbarrera and using his son's name as password: rafael. I fired off a quick email to Matt Blacker to let him know.

The case files include crime scene photos, mug shots, the correspondence from the police with the UK and also a ton of interview to translate. All good fun. Particularly the mug shots - nasty looking bunch. Updates here.

I'm not convinced that Schoenberg was really a "biopirate" - it just seems out of character. However his death is certainly suspicious, hopefully these files will provide some clarity.

Open Access Commenting - An Opportunity.

noreply@blogger.com (Mike) — Sat, 07 Feb 2009 19:24:00 +0000

Open Access publishing is a Very Good Thing. It's a model of publishing scientific journals where, rather than having to pay for access and running the lottery of whether your institution library has a subscription, whether you're on the right internet connection or you picked the right publisher to link to a journal through, the article is freely available at a click. It's freely available because the author of the article has coughed up a fee (several hundred to a couple of thousand dollars/pounds/euros) when they had it accepted in the journal. Funders of research are cottoning on to the fact that if they give the scientists a bit of money to pay this fee then open access means more people can see the research and they get a bit more kudos too. Everyone's a winner.

There's a list of open access journals at the wittily named Directory of Open Access & Hybrid Journals, but the two big names are BioMed Central and Public Library of Science. Both offer open access (BMC started doing so a little before PLoS, though PLoS is exclusively open access), and both charge fees for publishing; BMC is for-profit and PLoS not. Open access has also resulted in more experimentation with the standard publishing model - some journals allow reviewers of manuscripts to make their comments public (also a Very Good Thing - it hopefully stops the venting of frustrations that some reviewers seem to relish - Environmental Microbiology publishes select examples of these in their Christmas issue, which is a good laugh for everyone except the poor person at the bench who had their next grant riding on the publication) and even allow comments from readers. PLoS One has taken this the furthest, where commenting on papers can be located to specific items within the text.

It's this that's really interesting. Allowing readers to comment on papers adds a lot of value to them; other scientists might ask for clarification of points, suggest contrasting views, or develop collaborations. The article potentially becomes the start of a debate leading to further findings - how exciting! Only, in reality, this doesn't really happen. According to research available at Nascent (a blog from the publisher Nature - note, not an open access publisher) BioMed Central articles, between November 2002 and January 2008 managed 945 comments. By my reckoning that's about 3 comments a week shared between all these journals. Lordy! They must smell bad. Something for rivals PLoS to crow about? Not really, they have the same problem and Nascent is soliciting help from people to categorise PLoS's comments in the same way as they did for BMC.

But why is this the case?

Any one journal article is going to have a small pool of interested people - research is incremental and takes place in little niches, occasionally research has impact outside its own niche and that's probably when you would get more comments. The Nascent article doesn't correlate number of comments by impact of the paper.

Comments are more formal than in other places where users can leave comments and require more careful formulation - YouTube for example. The top three comments on the current most viewed vid are "omg, brilliant!!!!!","man u r craz" and "Awsome!" Not the sort of comment you're likely to get at BMC as scientists talk to each other in a different way and are likely to be judged by the authors on the quality of their comment. Though I know plenty of researchers are thinking "that tedious old ham has been churning out the same old crap for years" they're unlikely to say that to the author's faces. Mostly. A large number of the comments are actually from the authors themselves, adding additional reference material or acknowledgements - a nice thing to be able to do.

The reality of the situation is that you're not going to get many comments on journal articles and actually, it doesn't matter. One thing the Nascent article does conclude is that the comments generally improve the value of the article they're left on. Even if that happens on only one or two articles, it has justified the inclusion of a commenting mechanism. Also, it's likely to get steadily better, scientists are a recalcitrant bunch for people who are supposed to be at the cutting edge of knowledge, they have a lot of inertia when it comes to change.

However, I think the publishers are missing a trick. Commenting mechanisms would be a great tool for public engagement. Let's compare that youtube video again to a random paper from PLoS (OK, I admit it's not entirely random, I know some stuff about probiotics). Quite a lot of people like listening to music, quite a lot also like classical music, many can appreciate the skill in video-editing, guitar-playing and one or two might think he's silly for wearing that hat (not me of course - my hairline's receding and shortly I will be wearing a hat whenever I'm in public). Our random paper is about probiotics, you can buy them in the supermarket and quite a few people down them regularly, they improve the health of your digestive systems (well, some do, some don't, it's complicated). It's also about inflammatory bowel disease; most people with internet access also have a bowel, 1 in 400 people in the UK have IBD and the figure is similarly high in the US. That's a lot of vested interest. Scientific language is complicated, and deliberately so - complicated concepts have to be conveyed unambiguously to allow the sharing of research with other scientists, but it also creates a barrier to those that have never heard of subepithelial cells or mucosa.

If publishers encouraged (or even required?) authors to produce a peer-reviewed, lay summary of the work in the paper and then allowed general commenting, think of the benefits. The scientists would learn something about public engagement, highlighted as lacking in Robert Winston's recent New Scientist article. The public would be able to see behind the dusty drapes of these massive archives of human knowledge. The two groups might even start to chat about research, its impact and its importance or otherwise.

PLoS and BMC have the tools ready-made for something like this, it'll be interesting to see whether either of them take their publishing one step further.

The things my thesis doesn't say...

noreply@blogger.com (Mike) — Fri, 06 Feb 2009 22:59:00 +0000

I finally completed my PhD thesis in 2005, after starting in 2001. I took the full year to right up, which was silly and self-indulgent of me. I could have completed it in a couple of months if I hadn't kept staring at a blank pages in Word with an even blanker mind. In fact I could have completed it in just the one month had I not used Word at all, particularly the mystifying master document function which, although it allowed you to make a large document with lots of images and format the table of contents and bibliography, this document was a wobbly, paranoid, mental wreck that would crash if there was a slight breeze. Actually, that probably also describes my own state whilst I was writing.

Before I started at Warwick with Colin (noted for being a big name in methane metabolism and having a penchant for Bombay Mix - these facts are unconnected) I was applying for all sorts of PhDs along the theme of quorum sensing - bacterial communication (cool huh?!). Colin was my undergraduate tutor and suggested that I consider a PhD with him as he had a position available that had just been abandoned by the previous applicant. It wasn't in quorum sensing, but it did have a six weeks research cruise in the Arabian Sea associated with it; I was sold. It was still microbial ecology, but that seemed less important than traversing the Indian Ocean, from the Seychelles to Oman, ocasionally filtering water. Brilliant!

My thesis doesn't mention: giant tortoises; smuggled gin disguised as water samples; having my head shaved as we crossed the equator (in a weird "crossing the line ceremony" that seemed to serve only as an excuse for the crew to cross-dress), the day when the salps bloomed and the samples were all fouled with jellies, and catching squid and peeling them for dinner (Nick Fuller particularly enjoyed this, see macabre expression). It doesn't mention the night when we sailed through a Noctiluca bloom, a river of phosphorescent blue algae stretching to the horizon, so bright that we couldn't see where they ended and the stars began. It also doesn't mention the planes going into the twin towers (which we were largely ignorant of, having sporadic access to BBC World Service) or the fact that we were heading into a slightly less than safe patch of water in the Strait of Hormuz - dubbed Exocet Alley in the latter stages of the cruise (at one point I was reassured by a member of the crew that should we be struck by a missile we wouldn't explode, just vanish in a puff of rust - RRS Charles Darwin has since been retired). It doesn't mention colleagues that scream and invent bizarre dance moves, make odd noises when pleased or nervous, that drink the vinegar from pickled-beetroot jars, that are excellent substitutes for professional removals companies or that take pleasure in torturing small stuffed Sesame Street characters (it's difficult to decide whether Grover submerged in liquid nitrogen or Grover with his head sewn on backwards were my particular favourites) or who don't realise that Otis Spunkmeyer muffins shouldn't be abbreviated to just 'spunk' for reasons of decency.

It does mention the fantastic people I got to work with and that supported me in the labs at Warwick and PML, and at home; one reason why I'm making it more available than it currently is (just in the library at Warwick or above my desk). I think it also gives a sense of the difficulties of cross-disciplinary research (I'm no marine chemist), in those thrilling chapters of, if not unsuccesful, certainly tribulation-flavoured science. Aside from that, it's here for self-promotion and so I can sit secure in the knowledge that should I lose every copy, it might be lurking somewhere on the internet.

There are three important parts to read: the dedication on page ii; the acknowledgements on page xi; every sweat-soaked, brain-numbing, agony-inducing last word. I wept blood over this thing for four years! I know the plot's not thrilling and the finale is limp, but you can spare ten minutes to scan it can't you? There's pictures?

Marine Methyl Halide Utilising Bacteria

Publish at Scribd or explore others: Theses Academic Work bacterial diversity gas chromatography

Breed With Me

noreply@blogger.com (Mike) — Tue, 27 Jan 2009 22:10:00 +0000

I don't think that counts as double entendre, but I can't resist them either

Some fun little flash games look likely in Routes, a genetics based game from Channel 4 and The Wellcome Trust (so REAL science involved then - hurrah!). Plus it looks like it's going ARGy too - linky. And points mean prizes too. What more could you want?

Sekrits

noreply@blogger.com (Mike) — Wed, 24 Dec 2008 18:09:00 +0000

Did you know that World Without Oil in its originally planned form was called World Without Doilies, designed to document 32 weeks of global crisis resulting from the poor display of teacakes? If you could see the original planning documents you'd realise that The Dark Knight was never intended to have an associated ARG, and if it wasn't for a scheduling error Why So Serious? would have been promoting Mamma Mia (that must have taken some fancy footwork on the part of the puppetmasters).

I should also mention the The Lionel Blair Project (much scarier than the final release), The Breast and Perspex City. Of course, I wouldn't know this if I didn't have special access to the sekrit archive of ARG design documents. On pain of being forced to moderate Cloverfield 2: TINAG (there is not a game) I can't reveal much more.

In the spirit of Christmas though, here is the brief (via drop.io) that Law37 submitted to the Let's Change the Game competition. You can see exactly what we'd said we'd do and compare it with what we actually managed to make, hopefully that's useful to anyone who wants to make an ARG and never has. Juliette has released her slides from the Let's Change the Game Conference (as have the other speakers), which includes some stats concerning the game and we've conducted our own post mortem that we hope will also be available in the future. We're certainly no experts and the entire production was a learning experience, by releasing these documents hopefully others can learn from our mistakes. My favourite section is the budget, we didn't really have one. I can remember pricing up rubber ducks though; it's surprisingly hard to find duck wholesalers in the UK.

Futility

noreply@blogger.com (Mike) — Sat, 20 Dec 2008 23:05:00 +0000

The UK RAE 2008 results were released on the 18th. The R, A and E stand for Research, Assessment and Exercise respectively and (according to their website) it is "the principal means by which institutions assure themselves of the quality of the research undertaken in the HE [Higher Education] sector."

Except it isn't.

It's a great big pain in the arse. A white elephant. It's a white elephant in the arse. And that's a lot of pain.

Though I do like the inclusion of the words "assure themselves" in that statement. It's like admitting that universities are neurotic narcissists and noone else cares.

It happens like this: the research funding councils (HEFCE, SFC, HEFCW and DEL - I'd link, but their sites aren't very exciting) ask the universities to submit details of their research staff, how many papers they've produced and where they're published, how much research money they've generated and other bits and pieces (see here for the thrilling details). The universities go to their departments and say "Oi, make us look good or else we cut your budget for leather elbow patches and comfy chairs". The heads of departments lean on the academics to produce reams of output (neglecting their research and teaching activities in the meantime) and then HEFCE and their friends get to tot up all the information by subject area and tell the university how good they are by department.

My favourite part of the results is the following quote from news section of the website.

The results demonstrate that 54% of the research conducted by 52,400 staff submitted by 159 universities and colleges is either 'world-leading' (17 per cent in the highest grade) - or 'internationally excellent' (37 per cent in the second highest grade).

Taking the top three grades together (the third grade represents work of internationally recognised quality), 87% of the research activity is of international quality. Of the remaining research submitted, nearly all is of recognised national quality in terms of originality, significance and rigour.

Of course 87 % is of international quality! They funded it. They're not going to say, 'sorry fellas, we thought that it was a bit poo this time, try harder'! The remaining 13 % is a bit worrying though isn't it? Especially considering universities don't have to submit all their staff and can keep the rubbish ones locked away in broom cupboards until after the submission date.

Other fun effects of the RAE include not being able to get a job. Before the submission date universities strategically hire people with lots of nice papers in good journals. After the submission date you can't get a job for love nor money as they're bloated with staff and no one wants to hire until after the results are out. This is because the RAE determines how much money the university, and hence department, actually gets. If the score should be bad it can lead to closures of whole departments. I timed the end of my last post doc with this wonderful doldrums, which lasts for many months until the results are actually out.

This could get me onto a rant about post doccing in general (we don't count for the RAE), scientific publishing and all sorts of lovely, blood-boiling subjects. But I shall resist and end with the best explanation of the RAE procedure that I could find. Via MicrobiologyBytes.

Stroking (Egoes and Guitars)

noreply@blogger.com (Mike) — Thu, 18 Dec 2008 03:21:00 +0000

Operation: Sleeper Cell got picked by the frankly delicious Aleks Krotoski as one of her five highlights of the game year on the Guardian Games Blog, alongside such eclectic wonders as Braid, PMOG and Little Big Planet (and two other things that I haven't heard of, but will now investigate). Happy Christmas Law37! The money raised by our, also delicious (and probably custard cream flavoured) players is more than enough compensation for the sweat and tears (I'm fairly sure there wasn't any blood, I would have fainted), but this is nice too.

You can do more than just watch our egoes be stroked though, you can actively stroke someone else's. The Shorty Awards are for the year's top Twitter users, Madame Zee by Andrea Phillips and Good Captain by Jay Bushman are nominated and deserve more. To nominate either or (go on, be a devil, it's Christmas) both click these links: Madame Zee, Good Captain.

Enough of egoes and on to guitars, here are Angus and Julia Stone with tiny elephants and a grandiose gallimaufry of circussy thesps. He's got fireworks in his eyes. In his EYES?! Thanks for the tip Helen ;)

You Crawled out of the Sea

noreply@blogger.com (Mike) — Tue, 02 Dec 2008 02:32:00 +0000

Laura Marling inveigles her way into my head and I find myself humming her. Particularly the following the part of Cross your Fingers that goes "jump into your grave and dieeeee" and the part of the interlude that follows with "you crawled out of the sea, straight into my arms", which always brings to mind a cuttlefish heaving itself out of the ocean and making a doomed bid for the girl it's just fallen in love with on the beach. Cuttlefish have blue blood you know (haemocyanin rather than haemoglobin). And three hearts. <3 <3 <3

Sad Sack: Action Hero

noreply@blogger.com (Mike) — Thu, 27 Nov 2008 01:45:00 +0000

Ah, the Raggy Dolls! Known mainly for the theme tune (can anyone actually remember a plot, what they did or why they existed?), and relegated to those conversations when everyone works out how old you are from what kids' TV programmes you remember, "Chorlton and the Wheelies?! You're ancient!!". Consequently I only admit to being a fan of Bucky O'Hare (He Man? Who's he?). I found them (brace yourself for sacrilege) boring.

I have a soft spot for animations. The following is a really good one by Shane Acker I spotted on io9 and it's apparently going to be developed into a full length version, I hope it keeps its quality and spirit. When you're watching the Raggy Doll connection soon becomes apparent. If only Hi Fi, Sad Sack and Claude had had to face slathering, mechanical, skull-beasts it would have made the series much more exciting. Join in with me:

Soooo - if you are at ease
with your knobbly knees
and you're running for your life.
Construct a deadly trap
and sharpen up a knife...

9 Nine Shane Acker Short Animation
by FrFKmeron

Pika Pika - The Grand Unveiling.

noreply@blogger.com (Mike) — Sat, 22 Nov 2008 18:50:00 +0000

Note: there is a Christmas theme and that the second from left image on the bottom row should in fact read "Ho Ho (Tokyo)", rather than the less festive "Homo (Tokyo)" that we actually ended up with.