The World of Genetics

Biomedical : Online Tools for Primer Design and Analysis

2010-02-10T06:29:00.000-08:00

Online Tool	Description
AutoPrime	Primer design for real-time PCR measurement of eukaryotic gene expression.
CODEHOP	COnsensus-DEgenerate Hybrid Oligonucleotide Primers designed from protein multiple sequence alignments.
ExonPrimer	Design intronic primers for PCR amplification of exons. Input needed: a cDNA and the corresponding genomic sequence.
IDT AntiSense Design	Antisense oligo design and selection tool.
IDT Oligo Analyzer	Online calculation of oligonucleotide parameters such as melting temperature. Shows self-dimers, hairpin, and performs Blast.
IDT PrimerQuest	Primer and probe design and selection.
NetPrimer	Java applet for primer design.
Oligonucleotide Analyzer	Generates Tm, free energy, molecular weight and hairpin and dimer formation structures.
Primer3	Utility for locating oligonucleotide primers for PCR amplification of DNA sequences.
PrimerX	Automated design of mutagenic primers for site-directed mutagenesis.
Primo Pro	PCR Primer Design.
QuantPrime	Automatic high-throughput primer pair design and specificity testing for realtime qPCR on any organism.
RNAi Design	Design duplexed RNA oligos for RNA interference.
SiteFind	Design of oligonucleotide primers for site-directed-mutageneis that include a novel restriction for use as a marker of successful mutation.
UCSC In-Silico PCR	In-Silico PCR searches a genome sequence database with a given pair of PCR primers.
Web Primer	Primer design and sets for amplifying yeast ORFs.

Primer Design Considerations

Desired characteristics of automated DNA sequencing primer design.

Based on accurate sequence
Melting temperature (Tm): 52°C to 65°C
Absence of self-hybridization
Absence of significant hairpin formation (>3 bp)
Lack of secondary priming sites
Low specific binding at the 3' end (ie. lower GC content to avoid mispriming)

Primer Design

2010-02-10T06:16:00.000-08:00

What is a primer?

A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing. These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.

Analysis of primer sequences

When designing primers for PCR, sequencing or mutagenesis it is often necessary to make predictions about these primers, for example melting temperature (Tm) and propensity to form dimers with itself or other primers in the reaction. The following program will perform these calculations on any primer sequence or pair.

IDT DNA (Select Oligo Analyzer)

The programs will calculate both the Tm of the primers, as well as any undesireable pairings of primers. When primers form hairpin loops or dimers less primer is available for the desired reaction. For example...

Some thoughts on designing primers.

1. primers should be 17-28 bases in length;
2. base composition should be 50-60% (G+C);
3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;
4. Tms between 55-80^oC are preferred;
5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;
6. primer self-complementarity (ability to form 2^o structures such as hairpins) should be avoided;
7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

(adapted from Innis and Gelfand,1991)

Also keep in mind that most oligonucleotide synthesis reactions are only 98% efficient. This means that each time a base is added, only 98% of the oligos will receive the base. This is not often critical with shorter oligos, but as length increases, so does the probability that a primer will be missing a base. This is very important in mutagenesis or cloning reactions. Purification by HPLC or PAGE is recommended in some cases.

Oligonucleotide length	Percent with correct sequence
10 bases	(0.98)¹⁰ = 81.7%
20 bases	(0.98)²⁰ = 66.7%
30 bases	(0.98)³⁰ = 54.6%
40 bases	(0.98)⁴⁰ = 44.6%

Designing Degenerate Oligonucleotides.

A group of degenerate oligonucleotides contain related sequences with differences at specific locations. These are used simultaneously in the hope that one of the sequences of the oligonucleotides will be perfectly complementary to a target DNA sequence.

One common use of degenerate oligonucleotides is when the amino acid sequence of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produced matching those DNA sequences. The following link will take you to a program that will perform a reverse translation. http://arbl.cvmbs.colostate.edu/molkit/rtranslate/

For example, the amino acid sequence shown in purple below could be encoded by the following codons.

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C T C C C G
A A A A A
G G G G G

One could then select the 14 base sequence (in blue) to generate a smaller set of degenerate oligonucleotides. Each oligonucleotide in the set would have one base changed at a time (shown in purple below). A total of 32 unique oligonucleotides would be generated.

TATTGTTGGCTTCC

TACTGTTGGCTTCC

TATTGCTGGCTTCC

TACTGCTGGCTTCC

etc.

When ordering degenerate oligonucleotides, you just let the company know that you want a mixture of nucleotides added at a specific position using the code below. By adding the mixture, oligos will incorporate one of the bases, leading to a mixture of oligonucleotides.

Standard MixBase Definitions

A, G

C, T

A, C

G, T

C, G

A, T

A, C, T

C, G, T

A, C, G

A, G, T

A, C, G, T

Design primers 15-25 bp long that will amplify both of the sequences below.

You may wish to use an Alignment program to identify conserved regions in both sequences.

These sites would be good targets for PCR primers to bind to both sequences.

Recall that the two primers need to bind to the target DNA such that the free 3´ ends of each primer point towards each other.

You may wish to review the rules used design primers.

After you have identified the sequence of your primers, check the primers with the programs used to calculate melting temperature (T_m) and the formation of primer dimers.

If the T_m is less than 55^oC or bad hairpins or dimers form, try another region of sequence. A link to one possible answer is given at the bottom of the page.

>Paddlefish

CCTTGGCCTCTGCCTAATCACACAGATTCTAACAGGATTATTTCTCGCAATACACTACACAGCTGACA TCTCAACAGCCTTCTCCTCCGTCGCCCACATCTGTCGAGATGTTAACTACGGATGACTAATTCGAAAC ATTCATGCAAACGGAGCCTCCTTTTTCTTCATCTGCCTCTACCTTCACGTAGCCCGAGGCATATACTA TGGCTCATACCTCTACAAAGAAACCTGAAACATCGGAGTAGTTCTCCTACTCCTAACTATAATAACCG CCTTCGTAGGATATGTGCTCCCATGAGGACAGATATCCTTCTGAGGAGCCACCGTAATTACCAACCTT CTTTCCGCCTTCCCCTACATCGGGGACACCCTAGTACAATGAATCTGAGGTGGTTTCTCAGTAGACAA CGCCACCCTAACC

>Shovenose Sturgeon

CCTAGGCCTCTGCCTTATTACACAAATCTTAACAGGACTATTTCTTGCAATACACTACACAGCTGACA TTTCAACAGCCTTCTCCTCCGTCGCCCACATCTGCCGAGACGTAAACTACGGGTGACTAATCCGAAAC GTCCACGCAAATGGCGCCTCCTTCTTCTTTATCTGCTTGTACCTTCACGTCGCACGAGGTATATACTA CGGCTCCTACCTCCAAAAAGAAACCTGAAACATCGGAGTAGTCCTCTTACTCCTCACCATAATAACCG CCTTCGTAGGCTATGTACTGCCCTGAGGACAAATATCATTTTGAGGGGCAACCGTAATCACTAACCTC CTTTCCGCCTTCCCGTACATCGGCGACACATTAGTGCAATGAATCTGAGGCGGCTTTTCAGTC

Upon aligning the two sequences you would get the results below.

A vertical line indicates that the base is conserved in the two sequences, the absence of a line indicates a change. This makes it easy to identify conserved regions which would be good sites for a primer to bind to both sequences.

There are many possible answers to this problem. The two below are not necessarily the best, try several primer sequences to see which work best.

The sequence ccttggcctctgcct would make a good first primer. There is only one mis-match. However, it only has a T_m of 54^oC and forms a hairpin and dimers.

Instead, the sequence gccttctcctccgtcgccc is 74% GC with a T_m of 63^oC and doesn´t form hairpins or dimers. This would be a better primer, but the PCR product would be about 100 bp shorter. This would make a decent Primer 1.

Similarly the sequence cgatgtaggggaaggcggaaag is 59% GC with a T_m of 61^oC and doesn´t form hairpins or dimers. This would make a good Primer 2.

Query: 1 ccttggcctctgcctaatcacacagattctaacaggattatttctcgcaatacactacac 60
||| ||||||||||| || ||||| || |||||||| ||||||| ||||||||||||||
Sbjct: 1 cctaggcctctgccttattacacaaatcttaacaggactatttcttgcaatacactacac 60

Primer 1 5´gccttctcctccgtcgccc 3´
Query: 61 agctgacatctcaacagccttctcctccgtcgcccacatctgtcgagatgttaactacgg 120
||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 61 agctgacatttcaacagccttctcctccgtcgcccacatctgccgagacgtaaactacgg 120

Query: 121 atgactaattcgaaacattcatgcaaacggagcctcctttttcttcatctgcctctacct 180
|||||||| |||||| | || ||||| || |||||||| ||||| |||||| | |||||
Sbjct: 121 gtgactaatccgaaacgtccacgcaaatggcgcctccttcttctttatctgcttgtacct 180

Query: 181 tcacgtagcccgaggcatatactatggctcatacctctacaaagaaacctgaaacatcgg 240
|||||| || ||||| |||||||| ||||| |||||| | ||||||||||||||||||||
Sbjct: 181 tcacgtcgcacgaggtatatactacggctcctacctccaaaaagaaacctgaaacatcgg 240

Query: 241 agtagttctcctactcctaactataataaccgccttcgtaggatatgtgctcccatgagg 300
|||||| ||| ||||||| || |||||||||||||||||||| ||||| || || |||||
Sbjct: 241 agtagtcctcttactcctcaccataataaccgccttcgtaggctatgtactgccctgagg 300

Primer 2 3´gaaaggcggaaggggatgta
Query: 301 acagatatccttctgaggagccaccgtaattaccaaccttctttccgccttcccctacat 360
||| ||||| || ||||| || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 301 acaaatatcattttgaggggcaaccgtaatcactaacctcctttccgccttcccgtacat 360

gc 5´
Query: 361 cggggacaccctagtacaatgaatctgaggtggtttctcagt 402
||| ||||| |||| |||||||||||||| || || |||||
Sbjct: 361 cggcgacacattagtgcaatgaatctgaggcggcttttcagt 402

Purpose: to use a database to design specific PCR primers to amplify a region of DNA.

Go to Biology Workbench and log in.

Select Session Tools and then New Session.

Name the New Session Deer Bone

Next select Nucleic Tools and then Ndjinn (this is a search engine for DNA and protein sequences)

In the search window enter the following three ascession numbers separated by "or"

AF016978 OVU12869 BBU12864

Next scroll down and click the box next to the term GBMAM (GenBank Mammal)

When the three sequences appear, select Import Sequences

These three sequences will now be imported into your Deer Bone folder.

What region of DNA do these sequences correspond to? From which species?

Click on the boxes next to each sequence file and then select CLUSTALW

This program will align the three sequences.

Your assignment is to use this aligned sequence to design PCR primers which will amplify all three DNAs.

The Tm of the primers should be >50C. Also design the primers such that the PCR products from the two different species will be different sizes. This will allow for rapid identification of the species.

To check the Tm of primers use the program on the page PRIMER DESIGN in BioWeb.

To be turned in for credit:

qPrint out the report for the two primers you end up choosing, showing the Tm, length, etc.

qTurn in a printout of the aligned sequences with the location of the two primers indicated.

qWhat sized PCR product will you generate in each species?

pSET151

2010-02-10T06:09:00.000-08:00

Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).

2010-02-10T06:02:00.000-08:00

Free Software Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).

http://www.ncbi.nlm.nih.gov/tools/primer-blast/

Design of Primers for Automated Sequencing

2010-02-10T05:59:00.000-08:00

One of the most important factors in successful automated DNA sequencing is proper primer design. This document describes the steps involved in this process and the major pitfalls to avoid.

**** Use a Computer to Design Primers ****

We highly recommend that a computer be used during primer design in order to check for certain fatal design flaws. Numerous programs are capable of performing this analysis. We generally use 'Oligo' (National Biosciences, Inc, Plymouth MN), a program for the Macintosh that has produced excellent results in our hands. Two other programs you might consider are MacVector (Kodak/IBI) and the GCG suite of sequence analysis programs, but many others are available as well.

Some Basic Concepts: If you are confused by the strands and primer orientation, read this.

Sequencing primers must be able to anneal to the target DNA in a predictable location and on a predictable strand. They furthermore must be capable of extension by Taq DNA Polymerase.

Some people are confused about how to examine a DNA sequence to choose an appropriate primer sequence. Here are a few things for novices to remember:

Sequences are always written from 5' to 3'. This includes the sequence of your template DNA (if known), the sequence of the vector DNA into which it is inserted, and the sequence of proposed primers. Don't ever write a primer sequence reversed or you will only confuse yourself and others.
Polymerase always extends the 3' end of the primer, and the sequence you will read will be the same strand (sense or anti-sense) as the primer itself.
Thus, if you choose a primer sequence that you can read in your source sequence (for example, in the vector), the sequence you will obtain will extend from the primer's right (3') end.
Conversely, if you choose a primer from the strand opposite to what your 'source' sequence reads, the resulting sequence will read towards the left.

Here are a couple of examples:

Suppose you have a vector with the following sequence around the Multiple Cloning Site (the 'MCS'):

      TTAGCTACTGCTTGATGCTAGTACTACATCTAGTGCTAGATGGATCCGAATTCGCTGATGCTCATATGTTAATAAAGAC
                                               ^     ^
                                               |     |
                                             BamHI EcoRI

If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the primer 'CTTGATGCTAGTACTACATC' (remember - that's written 5' to 3') and you'll obtain the following sequence from the Core:

      TAGTGCTAGATG[your-insert-'top'-strand-Bam-to-Eco]AATTCGCTGATGC...(etc.)

What if you wanted sequence from the other strand - Eco to Bam - instead? In that case, you need to select some sequence on the right and then reverse-complement it before requesting the oligo. Picking out some sequence from the figure above:

      CTGATGCTCATATGTTAATA

This is NOT the primer sequence - it is copied verbatim from the above sequence. In fact, if you used this sequence for a primer, sequencing would proceed towards the right, away from your insert. Instead, reverse-complement that sequence:

      TATTAACATATGAGCATCAG

NOW this should produce sequence of the opposite strand:

      CGAATT[your-insert-'bottom'-strand-Eco-to-Bam]CATCTAGCACTA...(etc.)

Some fine print: Only rarely does sequencing actually show the nucleotides immediately downstream from the primer. I've taken some didactic license in the examples above.

More Advanced Concepts: How to Design a Primer that Works.

Generally you are starting with some small amount of known sequence that you wish to extend. Here's how to proceed:

I. Design primers only from accurate sequence data.

Automated sequencing (and in fact any sequencing) has a finite probablility of producing errors. Sequence obtained too far away from the primer must be considered questionable. To determine what is 'too far', we strongly suggest that our clients read the memo Interpretation of Sequencing Chromatograms, which describes how to assess the validity of data obtained from the ABI sequencers. Select a region for primer placement where the possibility of sequence error is low.

II. Restrict your search to regions that best reflect your goals.

You may be interested in maximizing the sequence data obtained, or you may only need to examine the sequence at a very specific location in the template. Such needs dictate very different primer placements.

Maximize sequence obtained while minimizing the potential for errors:
Generally, you should design the primer as far to the 3' as you can manage so long as you have confidence in the accuracy of the sequence from which the primer is drawn. Primers on opposite strands should be placed in staggered fashion as much as possible.
Targetted sequencing of a specific region:
Position the primer so the desired sequence falls in the most accurate region of the chromatogram. Sequence data is often most accurate about 80-150 nucleotides away from the primer. Do not count on seeing good sequence less than 50 nucleotides away from the primer or more than 300 nt away (although we often get sequence starting immediately after the primer, and we often return 700 nt of accurate sequence).

III. Locate candidate primers:

Identify potential sequencing primers that produce stable base pairing with the template DNA under conditions appropriate for cycle sequencing. It is strongly suggested that you use a computer at this step.
Suggested primer characteristics:

Length should be between 18 and 30 nt, with optimal being 20-25 nt. (Although we have had some successes with primers longer than 30 and shorter than 18).
G-C content of 40-60% is desirable.
The Tm should be between 55 C and 75 C. Warning: the old "4 degrees for each G-C, 2 degrees for each A-T" rule works poorly, especially for oligos shorter that 20 or longer than 25 nt. Instead, try:
```
Tm = 81.5 + 16.6* log[Na] + 0.41*(%GC) - 675/length - 0.65*(%formamide) - (%mismatch)                    
```
There's a web-based Tm calculator you might try at http://www.rnature.com/oligonucleotide.html.

IV. Discard candidate primers that show undesirable self-hybridization.

Primers that can self-hybridize will be unavailable for hybridization to the template. Generally avoid primers that can form 4 or more consecutive bonds with itself, or 8 or more bonds total. Example of a marginally problematic primer:

                   5'-ACGATTCATCGGACAAAGC-3'
                      ||||  ||||
           3'-CGAAACAGGCTACTTAGCA-5'

This oligo forms a substantially stable dimer with itself, with four consecutive bonds at two places and a total of eight inter-strand bonds.

Primers with 3' ends hybridizing even transiently will become extended due to polymerase action, thus ruining the primer and generating false bands. Be somewhat more stringent in avoiding 3' dimers. For example, the following primer self-dimerizes with a perfect 3' hybridization on itself:

                 5'-CGATAGTGGGATCTAGATCCC-3'
                          ||||||||||||||
                       3'-CCCTAGATCTAGGGTGATACG-5'

The above oligo is pretty bad, and almost guaranteed to cause problems. Note that the polymersase will extend the 3' end during the sequencing reaction, giving very strong sequence ACTATGC. These bands will appear at the start of your 'real' data as immense peaks, occluding the correct sequence. Most primer design programs will correctly spot such self-dimerizing primers, and will warn you to avoid them.

Note however that no computer program or rule-of-thumb assessment can accurately predict either success or failure of a primer. A primer that seems marginal may perform well, while another that appears to be flawless may not work at all. Avoid obvious problems, design the best primers you can, but in a pinch if you have few options, just try a few candidate primers, regardless of potential flaws.

V. Verify the site-specificity of the primer.

Perform a sequence homology search (e.g. dot-plot homology comparison) through all known template sequence to check for alternative priming sites. Discard any primers that display 'significant' tendancy to bind to such sites. We can provide only rough guidelines as to what is 'significant'. Avoid primers where alternative sites are present with (1) more than 90% homology to the primary site or (2) more than 7 consecutive homologous nucleotides at the 3' end or (3) abundance greater than 5-fold higher than the intended priming site.

VI. Choosing among candidate primers.

If at this point you have several candidate primers, you might select one or a few that are more A-T rich at the 3' end. These tend to be slightly more specific in action, according to some investigators. You may want to use more than one primer, maximizing the likelihood of success.

If you have no candidates that survived the criteria above, then you may be forced to relax the stringency of the selection requirements. Ultimately, the test of a good primer is only in its use, and cannot be accurately predicted by these simplistic rules-of-thumb.

Go to the University of Michigan DNA Sequencing Core's Home Page

PCR and Primer Design Bioinformatic Tools

2010-02-10T05:56:00.000-08:00

GeneFisher Interactive Primer Design GeneFisher Interactive Primer Design Tool.

MethPrimer MethPrimer is a program for designing...

OligoAnalyzer OligoAnalyzer tool for oligonucleotide analysis. Includes...

OligoCalc Calculate your primer parameters Melting temperature Tm,...

PCR Mastermix Box Titration Calculator This Bioinformatic Tool determines the amount of various...

PCR Optimization Program Helper PCR Optimization Program Helper. The program helps to...

Primer3 Primer3: pick primers from a DNA sequence. Great program.

The PCR Suite The PCR Suite. A collection of bioinformatic tools that...

WebPrimer WebPrimer. The easiest and best PCR tool we have used.

Designing Primers for PCR

2010-02-10T05:52:00.000-08:00

The Primer Designer features a powerful, yet extremely simple, real-time interface to allow the rapid identification of theoretical ideal primers for your PCR reactions. Primer pairs are computed from the set target regions, then screened against a series of parameters to maximise priming efficiency for trouble-free PCR.

The Display

The main Primer Designer form essentially consists of two grids and some parameter controls. The grids show all the possible forward (left side) and reverse (right side) primers that conform to the set parameters, and fall within the specified target regions for each primer. You will immediately notice, that by making the selection conditions for the primers more stringent, the list of possible primers will diminish. This real-time screening process makes it possible to very quickly narrow down the list of potential primers, and select the one(s) that best suit the needs for your experiment.

The regions from which the primers are chosen can be visualised and adjusted on the Interactive Sequence Map. The regions are represented by outlined boxes, colored green for the forward primers and purple for the reverse primers. The regions can be shifted by dragging them with the mouse, and their size adjusted by clicking on their edges and stretching them to the desired size. For fine adjustment of the region's position or size, simply select the whole box or the appropriate edge, then use the left and right arrows to shift your selection to the exact desired position. The primer selection regions are also shown in the Sequence Editor as light green and purple shaded regions.

The positions of the currently selected forward and reverse primers in the tables on the Primer Designer form, are shown on the Interactive Sequence Map as solid green and purple bars, and on the Sequence Editor as darkly shaded green and purple regions.

Adjusting the Primer Selection Parameters

Various parameters can be adjusted on the Primer Designer form, allowing you to specify how the primers will be screened. Although the default settings of the parameters are adequate for a typical PCR reaction, you will probably need to adjust them to some extent depending on the nature of your experiment. The parameters and their functions are outlined in the table below:

Parameter	Function
Length Range	Specifies the minimum and maximum lengths of the primers.
%GC Range	Specifies the minimum and maximum percentage of GC content in the primer. Efficient primers generally have %GCs of around 50.
Tm Range	Specifies the minimum and maximum melting temperature (in degrees Celcius) of the primer, as calculated by the Nearest Neighbor method (see below).
3' End Stability	Determines the DG of the last 5 bases at 3' end. An unstable 3' end (less negative DG) will result in less false priming.
5' End Stability (GC Clamp)	Determines the DG of the last 5 bases at 5' end. A stable 5' end (more negative DG) will result in more efficient and specific bonding to the template.
DG Dimer	Specifies the minimum tolerable DG for primer dimer formation.
DG Hairpin	Specifies the minimum tolerable DG for primer hairpin formation.

In the functions above, all the DG values are calculated according to nearest-neighbor method (Breslaur et al., 1986).

There are three commonly used methods for calculating the Tm. Expression uses the most accurate method, nearest-neighbor. The formulas and references for the different methods are summarised in the table below:

Method	Formula	Reference
Arbitrary	2(A + G) + 4(G + C)	Wallace et al. (1979)
Nearest Neighbor	(-1000 x deltaH) / (-10.8 - deltaS + R x ln(2.5^c/4)) - 273.15 - 16.6(log10 M) where c is the molar concentration of primer (set at 250 pM), M is the molar concentration of Na+ (set at 50 mM), and R is the gas constant (1.987)	Breslaur et al. (1986); Rychlik et al. (1990)
Long probe	81.5 + 16.6(log10 M) + 0.41(% GC) - 0.61(% form) - 500 / Length in bp where M is the molarity of Na+ (set at 0.75 M) and % form is the percentage of formamide (set to 50%)	Meinkoth and Wahl (1984)

Annotating your Primers

Once you have finished refining the stringency of your primer screening, and spotted the primers you would like to use, you can annotate their positions, and that of the PCR product, into your sequence for future reference. To do this, simply highlight the forward and reverse primers of choice by clicking on them on the tables on the Primer Designer form, and push the Annotate button. It really is that easy.

References

Breslaur KJ, Frank R, Blocker H, and Marky LA (1986). Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci, 83:3746-3750.

Meinkoth J, and Wahl G (1984). Hybridization of nucleic acids immobilized on solid supports. Anal Biochem, 138(2):267-284

Rychlik W, Spencer WJ, and Rhoads RE (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res, 18(21):6409-6412.

Wallace RB, Shaffer J, Murphy RF, Bonner J, Hirose T, and Itakura K (1979). Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch. Nucleic Acids Res, 6(11):6353-6357.

Using the Sequence Map

Annotating Your Sequences

Return to Expression Overview

Primer design webservers for PCR, mutagenesis and RNAi

2010-02-10T05:50:00.000-08:00

Probe/ primer design software

Primer design webservers for PCR, mutagenesis and RNAi

AntiSense Design - Design antisense primers at IDT
AutoPrime - designs primers that are specific for expressed sequences (mRNA).
BatchPrimer3 - High throughput web application for PCR and sequencing primer design
CODEHOP - COnsensus-DEgenerate Hybrid Oligonucleotide Primers
Exonprimer - Design primers for the amplification of exons with intronic primers
Genefisher - Interactive PCR primer design
MEDUSA - A tool for automatic selection and visual assessment of PCR primer pairs (Karolinska)
Methprimer - Design primers for methylation PCR
mPrimer3 - modified Primer3
MutScreener - Design primers for mutation screening (by PCR-direct sequencing)
NetPrimer - Free primer design service of Premier Biosoft.
Oligodb - a web-based system for interactive design of oligo DNA for transcription profiling (hybridization) of human genes. The oligodb system uses the human DNA-transcripts of ENSEMBL. Reference [PubMed][pdf]
Osprey - Oligonucleotide Design Software for Sequencing and Gene Expression
PCR suite - a collection of programs to search overlapping primers, genomic primers for exon amplification, SNP- and cDNA flanking primers
PRIDE - The less automated webversion of PRIDE (a.o. 50-70 mer oligo design)
Primaclade - a web-based application that accepts a multiple species nucleotide alignment file as input and identifies a set of PCR primers that will bind across the alignment.
Primer3 - a common used software for designing primers
Primer3Plus - Use primer3 to pick primers for specific tasks
PrimerQuest - Primer design at IDT
Primer Generator - Automated generator of primers for site-directed mutagenesis
PrimerStation - multiplex human PCR primer design site
PrimerX - Automated design of primers for site-directed mutagenesis
Primique - Automatic design of specific PCR primers for each sequence in a family
Primo Unique - Primo Unique finds multiple primer pairs, each uniquely amplify one gene in a family.
ProbeWiz Server - The CBS ProbeWiz WWW server predicts optimal PCR primer pairs for generation of probes for cDNA arrays. Reference [PubMed]
PUNS - Primer-UniGene Selectivity Testing - compares primer sequences against the both the genome and transcriptome to assess the potential for multiple amplicons (Free registration required)
RNAi Design - Design primers for RNAi at IDT
ROSO - Software to design optimized oligonucleotide probes (size over 25 nucleotides) for microarrays
Sirna - Target accessibility prediction and RNA duplex thermodynamics for rational siRNA design
SNPbox - a modular software package that automates the design of PCR primers for large-scale amplification and sequencing projects in a standardized manner resulting in high quality PCR amplicons with a low failure rate.
SNP Cutter SNP PCR-RFLP Assay Design. Primer design for restriction analysis of single nucleotide polymorphisms
Soligo - Target accessibility prediction and rational design of antisense oligonucleotides and nucleic acid probes
SOP3 - Selection of Oligonucleotide Primers for PCR and Pyrosequencing
SPADS - Specific Primers & Amplicon Design Software for amplification of individual members of gene families
PCR Primer design software for local installation

Freely available
Amplify - a freeware Macintosh program for simulating and testing polymerase chain reactions (PCRs).
AmplifX - Software to test, manage and design your primers for Macintosh and Windows.
Fast PCR - PCR primer design, DNA and protein tools, repeats and own database searches
MEDUSA - A tool for automatic selection and visual assessment of PCR primer pairs (Karolinska)
Methyl Primer Express - free Applied Biosystems software to design high quality PCR primers for methylation mapping experiments.
MutaPrimer - Designs primers for Stratagene's QuikChange site directed mutagenesis kits.
OligoPicker - OligoPicker picks specific oligos by skipping regions with contiguous bases common in other sequences. In addition, oligo specificity is double-checked by NCBI BLAST. Sequence regions similar to non-coding RNAs are avoided because total RNA is often used for array hybridization. Low-complexity regions are also filtered out to maintain oligo specificity. Oligos and sequence regions that may form secondary structures are discarded since both the probes and the sequence target sites should be easily accessible for hybridization. Reference [PubMed]
PRIMEGENS- PRIMEGENS (PRIMEr Design Using GEN Specific Fragments) is a computer program to select gene-specific fragments and then design primer pairs using Primer3 for PCR amplifications. Reference [PubMed]
PrimerD - The primerD program implements a novel algorithm for the design of unique degenerate primer pairs.
Primer3 - a common used software for designing primers for microarray construction.
mPrimer3 - modified Primer3
ProMide - ProMide is a collection of command-line tools for Probe selection and Microarray Design.
STACKdb - The STACKdb, Sequence Tag Alignment and Consensus Knowledgebase, is generated by processing EST and mRNA sequences obtained from Genbank through a pipeline consisting of masking, clustering, alignment and variation analysis steps. The STACKdb database is created using tools called "stackPACK".

Not freely available or commercial packages

AlleleID - For real time PCR based pathogen detection and bacterial identification. TaqMan probe design supported.
Beacon Designer - Real time PCR primer and probe design for single tube and multiplex PCR assays.
OligoChecker - An oligo database program which quickly checks which oligos available in a lab can be used on a given template (Shareware).
PRIDE and GenomePRIDE - (a.o. 50-70 mer oligo design)
Visual OMP - multiplex primer and probe design optimized to reduce cross-hybridization between oligos and targets, an integrated folding engine for visualizing target and oligo structures, thermodynamics modeling, and built-in BLAST and ClustalW. Product of DNA Software, Inc.

Microarray primer design webserver

MAPHDesigner 1.2 design of primers and probes for genome copy number detection (MAPH/CGH microarrays)
ROSO - Software to design optimized oligonucleotide probes (size over 25 nucleotides) for microarrays
MEDIANTE - Freely accessible database of human and mouse RNG/MRC oligonucleotide probes for microarrays

Microarray primer design software for local installation

Freely available
OligoArray2 - a free Java program that computes gene specific oligonucleotides for genome-scale oligonucleotide microarray construction. Reference [PubMed]
OligoWiz Site - Download the OligoWiz Java client to access the CBS OligoWiz WWW server and predict optimal oligonucleotides for generation of spotted arrays.
Probepicker - Featurama's Open Source Probepicker 0.7 for custom designed oligonucleotide microarrays
Primer3 - a common used software for designing primers for microarray construction.
Not freely available or commercial packages
Array Designer 2 - Design hundreds of primers for DNA or oligonucleotide microarrays. Product of Premier Biosoft.
PRIDE and GenomePRIDE - (a.o. 50-70 mer oligo design)
Sarani - Sarani Gold (Genome Oligo Designer) is a software for automatic large-scale design of optimal oligonucleotide probes for microarray experiments. Thousands of gene sequences can be analyzed together and best available oligonucleotide probes with uniform thermodynamic properties and minimal similarity to non-specific genes can be selected. Product of Strand Genomics.

In-silico PCR

Genome tester - tests 1) whether PCR primers have excessive number of binding sites on template sequence and 2) how many PCR products would be amplified from the template DNA and where are they located.
UCSC in-silico PCR - In-silico PCR on human genomic DNA at UCSC
In-silico experiments with complete genomes - In-silico experiments (including PCR) on bacterial and lower eukaryotic genomes

Primer property calculators

AutoDimer Rapid screen of previously selected multiplex PCR primers for primer-dimer and hairpin interactions in short DNA oligomers (<>
MultiPLX 2.0 tool to analyze PCR primer compatibility and automatically finding optimal multiplexing (grouping) solution.
OligoAnalyzer 3.0 at IDT
Oligonucleotide Properties Calculator
OligoTM 1.0 Program for calculation oligo melting temperature and GC content

PCR setup

Optimase Protocolwriter- Transgenomic
Optimase MasterMixCalculator- Transgenomic

A Comprehensive PCR Primer Design Software

2010-02-10T05:36:00.000-08:00

Primer Design for Standard PCR Assays

Primer Premier is the most comprehensive software to design and analyze PCR primers.

Primer Premier's search algorithm finds optimal PCR, multiplex, SNP genotyping and degenerate primers with the most accurate melting temperature using the nearest neighbor thermodynamic algorithm. Primers are screened for secondary structures, dimers, hairpins, homologies and physical properties before reporting the best ones for your sequence, in ranked order. Equipped with a handy calculator, you can easily manipulate sequences and analyze the results of your primer design.

Load the gene of interest from NCBI, select a search range, sit back and let Primer Premier pick the best possible primers for you.

Primer Design for SNP Genotyping Assays

With Primer Premier, you can load sequences from dbSNP and have the primers designed flanking the SNP selected. Hundreds of unpublished SNPs can also be loaded by specifying them as variation features in standard GenBank/dbSNP files. After specifying the SNPs, primers can be designed to amplify them for detection using a probe-based chemistry.

Multiplex Primer Design

For a multiplex experiment, Primer Premier enables you to design multiplex primers by launching a primer search in batch mode and then checking the cross reactivity of the primers designed. Primer Premier checks for all the possible reactivity and displays the most stable structure formed by each oligo. This functionality reduces false priming and ensures a strong signal strength.

Automatic Homology & Template Structure Avoidance

Primer Premier automatically interprets the BLAST search results and avoids those regions to design primers that have significant cross homologies with the database. These homologous regions are highlighted in the sequence view and are avoided during primer search.

Primer extension may be hindered due to the presence of template structures at extension temperature. To avoid all such regions, where the template may fold upon itself, the program utilizes a proprietary algorithm to check for possible secondary structures within the template at a folding temperature you specify. The regions involved in the formation of a secondary structure are underlined in the sequence view and are avoided while designing primers.

Avoiding homologous regions makes the oligos highly specific and avoiding template structures improves the efficiency of the designed primers.

and much more...

Download Now!

PCR Primer Design Guidelines

2010-02-10T05:33:00.000-08:00

PCR (Polymerase Chain Reaction)

Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th century in molecular biology. Small amounts of the genetic material can now be amplified to be able to a identify, manipulate DNA, detect infectious organisms, including the viruses that cause AIDS, hepatitis, tuberculosis, detect genetic variations, including mutations, in human genes and numerous other tasks.

PCR involves the following three steps: denaturation, annealing and extension. First, the genetic material is denatured, converting the double stranded DNA molecules to single strands. The primers are then annealed to the complementary regions of the single stranded molecules. In the third step, they are extended by the action of the DNA polymerase. All these steps are temperature sensitive and the common choice of temperatures is 94^oC, 60^oC and 70^oC respectively. Good primer design is essential for successful reactions. The important design considerations described below are a key to specific amplification with high yield. The preferred values indicated are built into all our products by default.

1. Primer Length: It is generally accepted that the optimal length of PCR primers is 18-22 bp. This length is long enough for adequate specificity, and short enough for primers to bind easily to the template at the annealing temperature.

2. Primer Melting Temperature: Primer Melting Temperature (T_m) by definition is the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability. Primers with melting temperatures in the range of 52-58 ^oC generally produce the best results. Primers with melting temperatures above 65^oC have a tendency for secondary annealing. The GC content of the sequence gives a fair indication of the primer T_m. All our products calculate it using the nearest neighbor thermodynamic theory, accepted as a much superior method for estimating it, which is considered the most recent and best available.

Formula for primer T_m calculation:

Melting Temperature T_m(^oK)={ΔH/ ΔS + R ln(C)}, Or Melting Temperature T_m(^oC) = {ΔH/ ΔS + R ln(C)} - 273.15 where

ΔH (kcal/mole) : H is the Enthalpy. Enthalpy is the amount of heat energy possessed by substances. ΔH is the change in Enthalpy. In the above formula the ΔH is obtained by adding up all the di-nucleotide pairs enthalpy values of each nearest neighbor base pair.

ΔS (kcal/mole) : S is the amount of disorder a system exhibits is called entropy. ΔS is change in Entropy. Here it is obtained by adding up all the di-nucleotide pairs entropy values of each nearest neighbor base pair. An additional salt correction is added as the Nearest Neighbor parameters were obtained from DNA melting studies conducted in 1M Na+ buffer and this is the default condition used for all calculations.

ΔS (salt correction) = ΔS (1M NaCl )+ 0.368 x N x ln([Na+])

Where
N is the number of nucleotide pairs in the primer ( primer length -1).
[Na+] is salt equivalent in mM.

[Na+] calculation:

[Na+] = Monovalent ion concentration +4 x free Mg2+.

3.Primer annealing temperature : The primer melting temperature is the estimate of the DNA-DNA hybrid stability and critical in determining the annealing temperature. Too high T_a will produce insufficient primer-template hybridization resulting in low PCR product yield. Too low T_a may possibly lead to non-specific products caused by a high number of base pair mismatches,. Mismatch tolerance is found to have the strongest influence on PCR specificity.

T_a = 0.3 x T_m(primer) + 0.7 T_m (product) – 14.9

where,

T_m(primer) = Melting Temperature of the primers

T_m(product) = Melting temperature of the product

4. GC Content : The GC content (the number of G's and C's in the primer as a percentage of the total bases) of primer should be 40-60%.

5. GC Clamp : The presence of G or C bases within the lat five bases from the 3' end of primers (GC clamp) helps promote specific binding at the 3' end due to the stronger bonding of G and C bases. More than 3 G's or C's should be avoided in the last 5 bases at the 3' end of the primer.

6. Primer Secondary Structures : Presence of the primer secondary structures produced by intermolecular or intramolecular interactions can lead to poor or no yield of the product. They adversely affect primer template annealing and thus the amplification. They greatly reduce the availability of primers to the reaction.

i) Hairpins : It is formed by intramolecular interaction within the primer and should be avoided. Optimally a 3' end hairpin with a ΔG of -2 kcal/mol and an internal hairpin with a ΔG of -3 kcal/mol is tolerated generally.

ΔG definition : The Gibbs Free Energy G is the measure of the amount of work that can be extracted from a process operating at a constant pressure. It is the measure of the spontaneity of the reaction. The stability of hairpin is commonly represented by its ΔG value, the energy required to break the secondary structure. Larger negative value for ΔG indicates stable, undesirable hairpins. Presence of hairpins at the 3' end most adversely affects the reaction.

ΔG = ΔH – TΔS

ii) Self Dimer : A primer self-dimer is formed by intermolecular interactions between the two (same sense) primers, where the primer is homologous to itself. Generally a large amount of primers are used in PCR compared to the amount of target gene. When primers form intermolecular dimers much more readily than hybridizing to target DNA, they reduce the product yield. Optimally a 3' end self dimer with a ΔG of -5 kcal/mol and an internal self dimer with a ΔG of -6 kcal/mol is tolerated generally.

iii) Cross Dimer : Primer cross dimers are formed by intermolecular interaction between sense and antisense primers, where they are homologous. Optimally a 3' end cross dimer with a ΔG of -5 kcal/mol and an internal cross dimer with a ΔG of -6 kcal/mol is tolerated generally.

7. Repeats : A repeat is a di-nucleotide occurring many times consecutively and should be avoided because they can misprime. For example: ATATATAT. A maximum number of di-nucleotide repeats acceptable in an oligo is 4 di-nucleotides.

8. Runs : Primers with long runs of a single base should generally be avoided as they can misprime. For example, AGCGGGGGATGGGG has runs of base 'G' of value 5 and 4. A maximum number of runs accepted is 4bp.

9. 3' End Stability : It is the maximum ΔG value of the five bases from the 3' end. An unstable 3' end (less negative ΔG) will result in less false priming.

10. Avoid Template secondary structure : A single stranded Nucleic acid sequences is highly unstable and fold into conformations (secondary structures). The stability of these template secondary structures depends largely on their free energy and melting temperatures(T_m). Consideration of template secondary structures is important in designing primers, especially in qPCR. If primers are designed on a secondary structures which is stable even above the annealing temperatures, the primers are unable to bind to the template and the yield of PCR product is significantly affected. Hence, it is important to design primers in the regions of the templates that do not form stable secondary structures during the PCR reaction. Our products determine the secondary structures of the template and design primers avoiding them.

11. Avoid Cross homology : To improve specificity of the primers it is necessary to avoid regions of homology. Primers designed for a sequence must not amplify other genes in the mixture. Commonly, primers are designed and then BLASTed to test the specificity. Our products offer a better alternative. You can avoid regions of cross homology while designing primers. You can BLAST the templates against the appropriate non-redundant database and the software will interpret the results. It will identify regions significant cross homologies in each template and avoid them during primer search.

Parameters for Primer Pair Design:

1. Amplicon Length : The amplicon length is dictated by the experimental goals. For qPCR, the target length is closer to 100 bp and for standard PCR, it is near 500 bp. If you know the positions of each primer with respect to the template, the product is calculated as: Product length = (Position of antisense primer-Position of sense primer) + 1.

2. Product position : Primer can be located near the 5' end, the 3' end or any where within specified length. Generally, the sequence close to the 3' end is known with greater confidence and hence preferred most frequently.

3. Tm of Product : Melting Temperature (T_m) is the temperature at which one half of the DNA duplex will dissociate and become single stranded. The stability of the primer-template DNA duplex can be measured by the melting temperature (T_m).

4.Optimum Annealing temperature (T_aOpt): The formula of Rychlik is most respected. Our products use this formula to calculate it and thousands of our customers have reported good results using it for the annealing step of the PCR cycle. It usually results in good PCR product yield with minimum false product production.

T_a Opt = 0.3 x(T_m of primer) + 0.7 x(T_m of product) - 25

where
T_m of primer is the melting temperature of the less stable primer-template pair
T_m of product is the melting temperature of the PCR product.

5. Primer Pair Tm Mismatch Calculation : The two primers of a primer pair should have closely matched melting temperatures for maximizing PCR product yield. The difference of 5^oC or more can lead no amplification.

Primer Design Using Software

A number of primer design tools are available that can assist in PCR primer design for new and experienced users alike. These tools may reduce the cost and time involved in experimentation by lowering the chances of failed experimentation.

Primer Premier follows all the guidelines specified for PCR primer design. Primer Premier can be used to design primers for single templates, alignments, degenerate primer design, restriction enzyme analysis. contig analysis and design of sequencing primers.

The guidelines for qPCR primer design vary slightly. Software such as AlleleID and Beacon Designer can design primers and oligonucleotide probes for complex detection assays such as multiplex assays, cross species primer design, species specific primer design and primer design to reduce the cost of experimentation.

PrimerPlex is a software that can design ASPE (Allele specific Primer Extension) primers and capture probes for multiplex SNP genotyping using suspension array systems such as Luminex xMAP® and BioRad Bioplex.

References :

1. “A critical review of PCR primer design algorithms and cross-hybridization case study” By F.John Burpo.
2. “Optimization of the annealing temperature for DNA amplification in vitro” By W.Rychlik, W.J.Spencer
and R.E.Rhoads.
3. “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics” By John SantaLucia.
4. “A computer program for selection of oligonucleotide primers for polymerase chain reactions” Lowe T, Sharefkin J, Yang SQ, Dieffenbach CW.
5. “Optimization strategies for the polymerase chain reaction” Williams JF.Perkin-Elmer Corporation, Norwalk, CT 06859-0251.
6. “Algorithms and thermodynamics for RNA secondary structure prediction. A Practical guide.” Zuker.m.athews, D.Turner, D.

Standard MixBase Definitions
	A, G
	C, T
	A, C
	G, T
	C, G
	A, T
	A, C, T
	C, G, T
	A, C, G
	A, G, T
	A, C, G, T

The World of Genetics

Biomedical : Online Tools for Primer Design and Analysis

Primer Design Considerations

Primer Design

pSET151

Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).

Design of Primers for Automated Sequencing

Some Basic Concepts: If you are confused by the strands and primer orientation, read this.

Here are a couple of examples:

More Advanced Concepts: How to Design a Primer that Works.

PCR and Primer Design Bioinformatic Tools

Designing Primers for PCR

Primer design webservers for PCR, mutagenesis and RNAi

Probe/ primer design software

Primer design webservers for PCR, mutagenesis and RNAi

PCR Primer design software for local installation

Freely available

Not freely available or commercial packages

Microarray primer design webserver

Microarray primer design software for local installation

Freely available

Not freely available or commercial packages

In-silico PCR

Primer property calculators

PCR setup

A Comprehensive PCR Primer Design Software

Primer Design for Standard PCR Assays

Primer Design for SNP Genotyping Assays

Multiplex Primer Design

Automatic Homology & Template Structure Avoidance

PCR Primer Design Guidelines

PCR (Polymerase Chain Reaction)

Primer Design Using Software